ID: 1125147986

View in Genome Browser
Species Human (GRCh38)
Location 15:36494877-36494899
Sequence CACCATATGGCACAGCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125147981_1125147986 6 Left 1125147981 15:36494848-36494870 CCAGATTGTTCTCTGAGCAGATC No data
Right 1125147986 15:36494877-36494899 CACCATATGGCACAGCAAGTGGG No data
1125147979_1125147986 18 Left 1125147979 15:36494836-36494858 CCCTTGGGGGCTCCAGATTGTTC No data
Right 1125147986 15:36494877-36494899 CACCATATGGCACAGCAAGTGGG No data
1125147980_1125147986 17 Left 1125147980 15:36494837-36494859 CCTTGGGGGCTCCAGATTGTTCT No data
Right 1125147986 15:36494877-36494899 CACCATATGGCACAGCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125147986 Original CRISPR CACCATATGGCACAGCAAGT GGG Intergenic