ID: 1125147988

View in Genome Browser
Species Human (GRCh38)
Location 15:36494886-36494908
Sequence GCACAGCAAGTGGGCAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125147981_1125147988 15 Left 1125147981 15:36494848-36494870 CCAGATTGTTCTCTGAGCAGATC No data
Right 1125147988 15:36494886-36494908 GCACAGCAAGTGGGCAATAGAGG No data
1125147979_1125147988 27 Left 1125147979 15:36494836-36494858 CCCTTGGGGGCTCCAGATTGTTC No data
Right 1125147988 15:36494886-36494908 GCACAGCAAGTGGGCAATAGAGG No data
1125147983_1125147988 -7 Left 1125147983 15:36494870-36494892 CCCAATTCACCATATGGCACAGC No data
Right 1125147988 15:36494886-36494908 GCACAGCAAGTGGGCAATAGAGG No data
1125147984_1125147988 -8 Left 1125147984 15:36494871-36494893 CCAATTCACCATATGGCACAGCA No data
Right 1125147988 15:36494886-36494908 GCACAGCAAGTGGGCAATAGAGG No data
1125147980_1125147988 26 Left 1125147980 15:36494837-36494859 CCTTGGGGGCTCCAGATTGTTCT No data
Right 1125147988 15:36494886-36494908 GCACAGCAAGTGGGCAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125147988 Original CRISPR GCACAGCAAGTGGGCAATAG AGG Intergenic