ID: 1125149845

View in Genome Browser
Species Human (GRCh38)
Location 15:36519281-36519303
Sequence CACTGCCACCTCTGTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317989
Summary {0: 20, 1: 2044, 2: 34806, 3: 109568, 4: 171551}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125149845_1125149851 12 Left 1125149845 15:36519281-36519303 CCCAGGAGACAGAGGTGGCAGTG 0: 20
1: 2044
2: 34806
3: 109568
4: 171551
Right 1125149851 15:36519316-36519338 ACCACTGCACTCCAGCTTAGGGG 0: 17
1: 185
2: 1889
3: 5671
4: 5374
1125149845_1125149850 11 Left 1125149845 15:36519281-36519303 CCCAGGAGACAGAGGTGGCAGTG 0: 20
1: 2044
2: 34806
3: 109568
4: 171551
Right 1125149850 15:36519315-36519337 TACCACTGCACTCCAGCTTAGGG No data
1125149845_1125149849 10 Left 1125149845 15:36519281-36519303 CCCAGGAGACAGAGGTGGCAGTG 0: 20
1: 2044
2: 34806
3: 109568
4: 171551
Right 1125149849 15:36519314-36519336 ATACCACTGCACTCCAGCTTAGG 0: 117
1: 4862
2: 66087
3: 210845
4: 256006

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125149845 Original CRISPR CACTGCCACCTCTGTCTCCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr