ID: 1125149846

View in Genome Browser
Species Human (GRCh38)
Location 15:36519282-36519304
Sequence TCACTGCCACCTCTGTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312965
Summary {0: 33, 1: 3229, 2: 56025, 3: 107913, 4: 145765}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125149846_1125149849 9 Left 1125149846 15:36519282-36519304 CCAGGAGACAGAGGTGGCAGTGA 0: 33
1: 3229
2: 56025
3: 107913
4: 145765
Right 1125149849 15:36519314-36519336 ATACCACTGCACTCCAGCTTAGG 0: 117
1: 4862
2: 66087
3: 210845
4: 256006
1125149846_1125149850 10 Left 1125149846 15:36519282-36519304 CCAGGAGACAGAGGTGGCAGTGA 0: 33
1: 3229
2: 56025
3: 107913
4: 145765
Right 1125149850 15:36519315-36519337 TACCACTGCACTCCAGCTTAGGG No data
1125149846_1125149851 11 Left 1125149846 15:36519282-36519304 CCAGGAGACAGAGGTGGCAGTGA 0: 33
1: 3229
2: 56025
3: 107913
4: 145765
Right 1125149851 15:36519316-36519338 ACCACTGCACTCCAGCTTAGGGG 0: 17
1: 185
2: 1889
3: 5671
4: 5374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125149846 Original CRISPR TCACTGCCACCTCTGTCTCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr