ID: 1125149850

View in Genome Browser
Species Human (GRCh38)
Location 15:36519315-36519337
Sequence TACCACTGCACTCCAGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125149845_1125149850 11 Left 1125149845 15:36519281-36519303 CCCAGGAGACAGAGGTGGCAGTG 0: 20
1: 2044
2: 34806
3: 109568
4: 171551
Right 1125149850 15:36519315-36519337 TACCACTGCACTCCAGCTTAGGG No data
1125149846_1125149850 10 Left 1125149846 15:36519282-36519304 CCAGGAGACAGAGGTGGCAGTGA 0: 33
1: 3229
2: 56025
3: 107913
4: 145765
Right 1125149850 15:36519315-36519337 TACCACTGCACTCCAGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125149850 Original CRISPR TACCACTGCACTCCAGCTTA GGG Intergenic
No off target data available for this crispr