ID: 1125153405

View in Genome Browser
Species Human (GRCh38)
Location 15:36559898-36559920
Sequence TGGTAGAGCCAGGATCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125153398_1125153405 22 Left 1125153398 15:36559853-36559875 CCCAGGGGAGTTAAGTAGTTTAC No data
Right 1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG No data
1125153399_1125153405 21 Left 1125153399 15:36559854-36559876 CCAGGGGAGTTAAGTAGTTTACC No data
Right 1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG No data
1125153400_1125153405 0 Left 1125153400 15:36559875-36559897 CCAAAGCCCATATAGCTTTTAAA No data
Right 1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG No data
1125153403_1125153405 -7 Left 1125153403 15:36559882-36559904 CCATATAGCTTTTAAATGGTAGA No data
Right 1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG No data
1125153402_1125153405 -6 Left 1125153402 15:36559881-36559903 CCCATATAGCTTTTAAATGGTAG No data
Right 1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125153405 Original CRISPR TGGTAGAGCCAGGATCTGAA TGG Intergenic
No off target data available for this crispr