ID: 1125156306

View in Genome Browser
Species Human (GRCh38)
Location 15:36590509-36590531
Sequence CAGAATTGCCTCAATTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125156306_1125156311 11 Left 1125156306 15:36590509-36590531 CCCTGCTAATTGAGGCAATTCTG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1125156311 15:36590543-36590565 GTCTTTTTCTGAGGTTGTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 178
1125156306_1125156308 2 Left 1125156306 15:36590509-36590531 CCCTGCTAATTGAGGCAATTCTG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1125156308 15:36590534-36590556 CGAAGCCCAGTCTTTTTCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 102
1125156306_1125156312 12 Left 1125156306 15:36590509-36590531 CCCTGCTAATTGAGGCAATTCTG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1125156312 15:36590544-36590566 TCTTTTTCTGAGGTTGTCCTGGG 0: 1
1: 0
2: 2
3: 31
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125156306 Original CRISPR CAGAATTGCCTCAATTAGCA GGG (reversed) Intronic
902210977 1:14904325-14904347 AAGAATTGCCTCACTTTGCAGGG + Intronic
904742425 1:32688674-32688696 CAGAATTGCCTGAACCCGCAAGG - Intronic
905840981 1:41177831-41177853 GAGAACTTCCCCAATTAGCAAGG + Intronic
907606681 1:55825225-55825247 CAGAATTTGGTTAATTAGCATGG - Intergenic
912255794 1:108056681-108056703 CAGAATTGCCATAATTAGAAAGG - Intergenic
923091586 1:230745166-230745188 CTGACTTGCCTCAACTTGCAAGG - Intergenic
1067723397 10:48747908-48747930 CAGAATGGCCTGAATGAGGATGG - Intronic
1073690414 10:105802018-105802040 CAGAAGTGCCTCTAATAGCTGGG + Intergenic
1078715798 11:13838023-13838045 CAGAATTTCTGCAATCAGCAAGG - Intergenic
1087507894 11:99051045-99051067 CAGAATAGCATCAATTAACATGG + Intronic
1088010882 11:104999503-104999525 CTGATGTGCCTCACTTAGCATGG + Intronic
1090097322 11:123755488-123755510 AAGAATAGCCTCAATAAGAAAGG - Intergenic
1096749980 12:53752271-53752293 CAGAAGAGCCCCAATTAGTAGGG - Intergenic
1105214919 13:18278415-18278437 CAGAATTGTCACTCTTAGCAAGG + Intergenic
1112685586 13:101821713-101821735 CAGAATTGCTAAAATTAACATGG - Intronic
1115032905 14:28818876-28818898 CAGAATTCCCTGAGTTAGTAGGG + Intergenic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1127229842 15:56978520-56978542 CAGAATTGTTTCAAAAAGCAAGG + Intronic
1128862515 15:71085808-71085830 CAGGATTGACTCCCTTAGCAAGG + Intergenic
1129506055 15:76082517-76082539 CAGAATTGCAGCAATTAACTTGG + Intronic
1130680111 15:85989259-85989281 CAGAATTGCCACACTGAGTAGGG + Intergenic
1133922827 16:10169352-10169374 CAAAATTGCTTCTGTTAGCAAGG - Intronic
1135082874 16:19451441-19451463 CAGAATGGCTTTAATTATCAGGG + Intronic
1140314356 16:73880191-73880213 CAGATTTGCCCCAAAAAGCAAGG + Intergenic
1141186666 16:81792389-81792411 CAGAATTGCTTGAATGTGCAAGG + Intronic
1146502775 17:33378570-33378592 TAGAATTGCCTCAAGAAGTAAGG + Intronic
1146554491 17:33812094-33812116 CACAATATCCACAATTAGCATGG - Intronic
1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG + Intergenic
1157279770 18:46338733-46338755 CTAAAATGCCTCATTTAGCAAGG - Intronic
1158406262 18:57162319-57162341 CAGAAATTCCTCAATAAACAAGG - Intergenic
1160831790 19:1107804-1107826 GAGAATTGCATATATTAGCAGGG + Exonic
926643727 2:15265745-15265767 CAGAACTGCCTGAATTGGAAAGG + Intronic
931107854 2:59076940-59076962 CTTCATTGCCTCAATTAGCATGG - Intergenic
934299401 2:91768322-91768344 CAGAATTGTCACTCTTAGCAAGG - Intergenic
935551535 2:104462830-104462852 CCTAATTGCCTCAATTTGAAGGG - Intergenic
936889283 2:117350287-117350309 CAGAATTGCCTCAAGGAAGATGG + Intergenic
939453742 2:142405884-142405906 CAGAATTTCCTCCATTTGTAAGG - Intergenic
940554262 2:155203281-155203303 CTGAGGTGCCTCAATTAGAATGG - Intergenic
941860202 2:170271470-170271492 CAGAAGTGTCTCAATTATGAAGG + Intronic
942762915 2:179420994-179421016 TAGAATTTCCTTAATTTGCAAGG + Intergenic
947999085 2:234552970-234552992 GAGAATTGCCTGAATTCGGAAGG + Intergenic
1170748410 20:19121490-19121512 CAGAATTGCCTCCACCAGGATGG - Intergenic
1171923117 20:31166974-31166996 CAGAATTGTCTCAAATAGAATGG + Intergenic
1173064201 20:39694223-39694245 CAGAATTTCCTAAATTAGCTCGG + Intergenic
1176417005 21:6481976-6481998 CAGATTTTCTCCAATTAGCAGGG + Intergenic
1179692503 21:43090309-43090331 CAGATTTTCTCCAATTAGCAGGG + Intergenic
1181869448 22:25886356-25886378 CAGAGCTGCCTCAGTCAGCAGGG - Intronic
1182649203 22:31836954-31836976 CAGAACTGCCTCACGTAACAGGG - Intronic
949261950 3:2113135-2113157 CTCAATTGCCTGAATTATCAGGG + Intronic
954407167 3:50351645-50351667 CAGAATTCCCTCAACCAGCCAGG - Intronic
954989256 3:54825412-54825434 CAGAATTGTATCTATAAGCAAGG - Intronic
955251516 3:57287612-57287634 CAGAATTACCTCATGGAGCAGGG - Intronic
959665078 3:108911542-108911564 CAGAATTGTGTTTATTAGCAAGG + Intronic
960045765 3:113196355-113196377 CAGAGTTGCCTCTATAAGCTTGG - Intergenic
960156776 3:114304662-114304684 CAGCACTTCCTCCATTAGCATGG + Intronic
962545822 3:136433903-136433925 TAGAATTGCCTAACTTAGAAAGG - Intronic
962703184 3:138018835-138018857 CAGAAGACCCTCAATGAGCAGGG - Intronic
966068863 3:175850125-175850147 AAGAACTGCTTCAAATAGCAAGG + Intergenic
967551779 3:190803703-190803725 CAGCATTGCATCAATTATCCAGG + Intergenic
968824950 4:2888503-2888525 CAGAATTGCCTGAACTCGGAAGG - Intronic
970127403 4:12830520-12830542 CACCAATACCTCAATTAGCAAGG + Intergenic
972553600 4:40158854-40158876 CAGAATTCACTCATTTTGCAAGG + Intergenic
978654493 4:111049774-111049796 CAGAATTCCCTGGATTACCAGGG - Intergenic
980321243 4:131279560-131279582 CATAATTTCCTCAATTCTCAGGG + Intergenic
986430197 5:7673857-7673879 CAGACATGCCTCAAATAGAATGG - Intronic
991012135 5:61894917-61894939 CAAAATTGGCTCTGTTAGCAAGG - Intergenic
995538454 5:113160710-113160732 CAGAATTAGCACAATTAGCATGG + Intronic
997936957 5:138120813-138120835 CAGACTTTCCTCAATTTACATGG + Intronic
1000378801 5:160610138-160610160 CAGAATTCCCTTCATTAGAAAGG - Intronic
1003450430 6:6226263-6226285 CATGAATGCCTCAAGTAGCAAGG - Intronic
1006312185 6:33268640-33268662 CAGAATTGCCCTGGTTAGCAGGG + Exonic
1008977605 6:57446326-57446348 CAGAATAGCTTCAATAAGAAAGG + Intronic
1011487120 6:87854119-87854141 CAGAATTGTCTGCATCAGCAGGG + Intergenic
1023502291 7:40863747-40863769 AAGAATTCCATCAATTAGAAGGG - Intergenic
1024265731 7:47605055-47605077 CAGAATTCTTTCAAATAGCATGG + Intergenic
1024899216 7:54298477-54298499 CAGAAATGTCTCAATTACCCTGG - Intergenic
1031184533 7:118459887-118459909 CAGAATTGTTTCACTTAGAAAGG - Intergenic
1031428823 7:121640237-121640259 CAGCATTATATCAATTAGCAAGG - Intergenic
1031743488 7:125465660-125465682 CAAAATTGCCTCCATTAGAAAGG - Intergenic
1032182704 7:129694452-129694474 GAGAATTGCCTCAATCTGGAAGG - Intronic
1033663540 7:143420543-143420565 CAGAATTGCCTAAGATTGCATGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042975855 8:74468655-74468677 GAGAATTGAGTAAATTAGCAGGG - Intronic
1043496502 8:80806741-80806763 CAGAATTCCCTGCATTTGCAAGG - Intronic
1043774896 8:84254322-84254344 CAGAATTGCTTCAGTTAGAGTGG - Intronic
1044636993 8:94335381-94335403 AAGAATTATCTTAATTAGCATGG + Intergenic
1045183494 8:99812297-99812319 TAGGATTTCCTCAATTGGCAAGG + Intronic
1045934338 8:107661744-107661766 CAGAATTTCCTGAATTTGAAGGG - Intergenic
1047136293 8:122082243-122082265 CAGAATTCCCTCTGGTAGCAAGG + Intergenic
1047993935 8:130315628-130315650 CTGGAGTGCCTCCATTAGCAGGG + Intronic
1048288056 8:133157834-133157856 CAGAATTGCCTCACTCAAGATGG - Intergenic
1049039357 8:140100378-140100400 CAGGAGTGCCTCAATTCACAGGG + Intronic
1050088808 9:1994854-1994876 GAGTCTTGCCTGAATTAGCATGG + Intergenic
1056321751 9:85441740-85441762 CAGAATTGTCTTAATTAGAGTGG - Intergenic
1061424888 9:130492721-130492743 CAGAATTGCTCCAGTTAGAAAGG + Intronic
1203725394 Un_GL000216v2:45516-45538 CAGAATGGACTCAAATAGAATGG - Intergenic
1189994068 X:46622296-46622318 CAGAAATGCCTCCATTTGCAGGG + Intronic
1191060568 X:56291369-56291391 AAGATTTGCCTCTGTTAGCATGG + Intergenic
1193558896 X:82993020-82993042 CAGAATTGCCTCAGTTGTCCAGG + Intergenic
1196373322 X:115002312-115002334 CAGAATTCCTTTAATTAGTAGGG + Intergenic
1201212849 Y:11696355-11696377 TAGAATTGACTCAAATAGAATGG + Intergenic