ID: 1125156311

View in Genome Browser
Species Human (GRCh38)
Location 15:36590543-36590565
Sequence GTCTTTTTCTGAGGTTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125156302_1125156311 23 Left 1125156302 15:36590497-36590519 CCAAACACCGGCCCCTGCTAATT 0: 1
1: 0
2: 5
3: 77
4: 2317
Right 1125156311 15:36590543-36590565 GTCTTTTTCTGAGGTTGTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 178
1125156301_1125156311 28 Left 1125156301 15:36590492-36590514 CCTGACCAAACACCGGCCCCTGC 0: 1
1: 0
2: 0
3: 13
4: 188
Right 1125156311 15:36590543-36590565 GTCTTTTTCTGAGGTTGTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 178
1125156304_1125156311 16 Left 1125156304 15:36590504-36590526 CCGGCCCCTGCTAATTGAGGCAA 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1125156311 15:36590543-36590565 GTCTTTTTCTGAGGTTGTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 178
1125156300_1125156311 29 Left 1125156300 15:36590491-36590513 CCCTGACCAAACACCGGCCCCTG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1125156311 15:36590543-36590565 GTCTTTTTCTGAGGTTGTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 178
1125156306_1125156311 11 Left 1125156306 15:36590509-36590531 CCCTGCTAATTGAGGCAATTCTG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1125156311 15:36590543-36590565 GTCTTTTTCTGAGGTTGTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 178
1125156305_1125156311 12 Left 1125156305 15:36590508-36590530 CCCCTGCTAATTGAGGCAATTCT 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1125156311 15:36590543-36590565 GTCTTTTTCTGAGGTTGTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 178
1125156307_1125156311 10 Left 1125156307 15:36590510-36590532 CCTGCTAATTGAGGCAATTCTGT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1125156311 15:36590543-36590565 GTCTTTTTCTGAGGTTGTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125156311 Original CRISPR GTCTTTTTCTGAGGTTGTCC TGG Intronic
901166029 1:7222251-7222273 GTCTTTTTCTGTGCTCGTCTGGG + Intronic
901196544 1:7443494-7443516 GTATTGTGCTGAGGTGGTCCAGG - Intronic
905627302 1:39497702-39497724 GTCCTGTTCTCAGGTTGTTCAGG - Intronic
906572510 1:46855908-46855930 GTCTTTTTCTGACGTATTCTTGG - Intergenic
906599260 1:47109987-47110009 GTCTTTTTCTGACGTATTCTTGG + Intronic
911063971 1:93771234-93771256 GACTTTTTCTGAGGTTACACAGG + Intronic
911821923 1:102434583-102434605 GTCTCTTTCTGACCTTGGCCCGG + Intergenic
912187811 1:107301332-107301354 GTTTCTTTCTGTGTTTGTCCAGG - Intronic
914172137 1:145234530-145234552 GTCTCTCTCTGAGGTTGTGTTGG + Intergenic
916193149 1:162198354-162198376 GACTTTTTGTGATCTTGTCCTGG + Intronic
917578097 1:176345195-176345217 GTGTTTTCCTAAGGTTGTACAGG + Intergenic
919005044 1:191887823-191887845 GTCTTTATCTGACGTTTTCCAGG - Intergenic
919243078 1:194939868-194939890 CTCTTCTTCTGAGGCTGTCAAGG + Intergenic
922419210 1:225448245-225448267 GGATCTTTGTGAGGTTGTCCTGG + Intergenic
923538616 1:234871841-234871863 GCCTTTTGCTGTGGTTTTCCTGG - Intergenic
1068304284 10:55184017-55184039 CTCTTTTTCTGATGCTTTCCAGG + Intronic
1069706779 10:70463678-70463700 GTCCTTATCTGATGTTTTCCTGG - Intergenic
1071974802 10:90944658-90944680 GTCTTCTTCTGAGGTTCTGAGGG - Intergenic
1072795893 10:98354341-98354363 ATCTTTGTTTGCGGTTGTCCAGG + Intergenic
1073072694 10:100804913-100804935 GTCTTCTTCAGATGTGGTCCTGG + Intronic
1073723719 10:106205459-106205481 TTCTTTTTCTGAAGCTGGCCAGG - Intergenic
1074202878 10:111255458-111255480 GTCTTATGCTGAGTCTGTCCTGG - Intergenic
1076141617 10:128083684-128083706 GTTTTTTTCTGAGGGTGGTCTGG - Exonic
1077476111 11:2791380-2791402 ATGTTTTTCTGAGGTTGGCCAGG - Intronic
1077807531 11:5604638-5604660 GACTTTTTCTGAAGATGTCCTGG + Intronic
1079153895 11:17926346-17926368 GTCTTCTTCTGTGGTTGTGGAGG - Intronic
1080425576 11:32151072-32151094 ATCTTTTTCTGTGTCTGTCCAGG - Intergenic
1081601332 11:44496909-44496931 GTCCATTTCTGAACTTGTCCTGG - Intergenic
1084274915 11:68046384-68046406 GGCTCCTTCTGAGGCTGTCCAGG + Intronic
1087021065 11:93603848-93603870 ATTTTTTTCTTAGGCTGTCCAGG + Intergenic
1087747245 11:101963209-101963231 TTCTTTTTTTGAGGCTGGCCAGG - Exonic
1088495933 11:110430785-110430807 GTCTTTGTCAGGGGGTGTCCAGG + Intronic
1088769027 11:113014726-113014748 GGATTTTTCTGAGGTCGTCTTGG + Intronic
1089675729 11:120087803-120087825 ATCTTTTTCTGTAGTTGTTCTGG + Intergenic
1091107926 11:132940333-132940355 CTCTTTTAATGTGGTTGTCCTGG - Intronic
1091550927 12:1534328-1534350 GTCTTTTCTTGAGGTTTTGCTGG + Intronic
1091702803 12:2674852-2674874 TTCTGTTTCTGAGTTTGTGCAGG - Intronic
1098584618 12:72141387-72141409 GTCTTTCTCTGTGGTTATCGGGG - Intronic
1099271139 12:80512808-80512830 CTCATTTTCTGAGGTAGTCTGGG + Intronic
1100097117 12:91054377-91054399 TGCATTTTCTTAGGTTGTCCTGG + Intronic
1102533211 12:113561930-113561952 GGCTGTTTCTGAGATTGTCCTGG + Intergenic
1105000390 12:132686987-132687009 GGCTCTTTCTGAGGTTTTTCGGG - Intronic
1105971165 13:25430198-25430220 CTCTTTTTCTGAGGTAGGCTGGG - Intronic
1106318382 13:28615477-28615499 GTCTTTTTCTAAAGTTCTCCAGG - Intergenic
1108454729 13:50601804-50601826 GTATTTGTCTGAAGGTGTCCAGG + Intronic
1108985474 13:56580921-56580943 GTCTTTTTCTGAGCTTAGTCAGG + Intergenic
1109019145 13:57062687-57062709 ATCTTTTTGTTAGGTTGTCTGGG - Intergenic
1109510669 13:63367944-63367966 GTCTTTTTCTCAGTGTGTCTGGG + Intergenic
1111648828 13:91064568-91064590 GTCTTGCTCTCAGGTTGTCCAGG - Intergenic
1111994889 13:95156185-95156207 ATATTTTTCTGATGTTGTCCTGG - Intronic
1117249793 14:53925430-53925452 GTCTCTTTCTGTTGCTGTCCTGG + Intergenic
1117412023 14:55458757-55458779 GTTTTTTTCTGATTTTGTACAGG - Intergenic
1120685560 14:87532582-87532604 ATCTATTTCTGAGTTTGTCATGG - Intergenic
1120956297 14:90086002-90086024 GTATCTTTGTGAGGTTGCCCAGG + Intronic
1121244179 14:92450561-92450583 TTCCCCTTCTGAGGTTGTCCTGG - Intronic
1121457742 14:94049471-94049493 GTAGTTTTCTGAACTTGTCCTGG + Exonic
1122400761 14:101465977-101465999 GTCTTACTCTGAGGTTTCCCAGG + Intergenic
1123665012 15:22601436-22601458 GGCTTTTGCTGTGGTTGCCCAGG - Intergenic
1124318842 15:28695855-28695877 GGCTTTTGCTGTGGTTGCCCAGG - Intergenic
1125156311 15:36590543-36590565 GTCTTTTTCTGAGGTTGTCCTGG + Intronic
1126079983 15:44950331-44950353 GTTTTTTTCTGGGGTTATGCTGG + Intergenic
1128947312 15:71836166-71836188 GTCTTTTTCTGATGTTCTGTAGG - Intronic
1129276797 15:74450848-74450870 CTCTTTTTCAGGGGTTCTCCAGG - Exonic
1134643140 16:15845371-15845393 TTCTTTTTCTGGGGTGGCCCAGG + Intronic
1135872396 16:26162899-26162921 GTCATATTCTGAGGTTATCATGG + Intergenic
1136172237 16:28496156-28496178 CTCTTTGCCTGAGGTTGTCCAGG - Exonic
1137351279 16:47716127-47716149 GTTTTTTTCTGGGGTTCTCTTGG - Intergenic
1138372034 16:56534800-56534822 GTTTTTTTCCGTGTTTGTCCAGG + Intergenic
1139152851 16:64405390-64405412 GTCTTTTTGTGAAGTTTGCCTGG + Intergenic
1141330342 16:83105300-83105322 GTTTTTCTCTGAGTCTGTCCTGG + Intronic
1141706336 16:85667231-85667253 GCCTTATTCTGACCTTGTCCTGG + Intronic
1142017774 16:87760296-87760318 GACTTTTTTTTATGTTGTCCAGG - Intronic
1143873839 17:9976778-9976800 ATTATTTTTTGAGGTTGTCCTGG - Intronic
1147358619 17:39917321-39917343 TTCTGTTTCTGAGTTGGTCCAGG - Exonic
1147398938 17:40167485-40167507 TTCTTTGTCTCAGGGTGTCCAGG + Exonic
1147625263 17:41896077-41896099 ATCTTTTTCTGGGGTTGTGGTGG - Intronic
1149883217 17:60314162-60314184 GTCTTTCTCTGTTGTTGCCCAGG + Intronic
1150100374 17:62418008-62418030 GTATTTTTCTGTGGTTCTCAAGG + Intergenic
1151205625 17:72504417-72504439 TTCTTTTTCCTATGTTGTCCAGG - Intergenic
1153893809 18:9541447-9541469 GTCATTTACTGAGATTTTCCTGG - Intergenic
1155889287 18:31246655-31246677 ATCTTTTTCTGGGGTTGTCGGGG - Intergenic
1156690568 18:39702116-39702138 ATCTCTGTATGAGGTTGTCCTGG - Intergenic
1156897236 18:42259650-42259672 GTCTTTTTCTCAAGTTGTAGGGG + Intergenic
1157105278 18:44768817-44768839 GTCTTCTTATGAGGGTTTCCAGG - Intronic
1161013386 19:1970738-1970760 GTCTGTTGCTGGGGTTGTCCGGG + Intronic
1165886622 19:39083853-39083875 GTTTTGTTTTGAGGTTGCCCCGG + Intergenic
1168135920 19:54351801-54351823 GATATTTTCTGAGGGTGTCCAGG - Exonic
925820937 2:7799444-7799466 GGAGTTTGCTGAGGTTGTCCAGG + Intergenic
926504939 2:13702303-13702325 GTCCTTCTCAGAGGCTGTCCTGG - Intergenic
928893735 2:36237293-36237315 GAGTTTCTCTGAGGTTGTCTGGG - Intergenic
931185767 2:59949739-59949761 ATTTTTTTTTGAGGTTGTTCAGG - Intergenic
931779428 2:65566652-65566674 CTCTTTTTCTCAGGGTGTCCTGG + Intergenic
934725171 2:96612246-96612268 ATCTTATTTGGAGGTTGTCCTGG - Intronic
936448726 2:112617479-112617501 ATCTTTTTGTCATGTTGTCCAGG - Intergenic
937548872 2:123061422-123061444 GGCTGTTTCTGAGATTCTCCTGG + Intergenic
937711638 2:124986324-124986346 GTCTTTTCCTAAGGATGGCCTGG + Intergenic
945586308 2:211668315-211668337 TTCTTTTTCTGAGATTTGCCAGG - Intronic
946176023 2:217922422-217922444 TTCTTTTTCTGAGCTTGGGCTGG + Intronic
946186064 2:217981011-217981033 GTTATTTTCTGAAGTTGCCCTGG + Intronic
946720423 2:222600147-222600169 GACTTTTTCTAAGTTTGTACTGG - Intronic
948120670 2:235528067-235528089 GGCTCTTTGTGATGTTGTCCTGG + Intronic
948452511 2:238084967-238084989 GCCATTTTCTGACGTTGTGCTGG - Intronic
1172380443 20:34486038-34486060 GTCTCACTCTGAGGTTGCCCAGG + Intronic
1173098258 20:40059293-40059315 GGGTTTTTCTGATGCTGTCCTGG + Intergenic
1175761389 20:61564155-61564177 GTCTTAGGATGAGGTTGTCCTGG - Intronic
1176915201 21:14617323-14617345 GTCTTTTTCTGAAATTGTTTAGG + Intronic
1177347242 21:19889717-19889739 GTCTTTTTCTAAGCTCCTCCTGG - Intergenic
1178800843 21:35794112-35794134 GTCTTTTTCTGAAGTTGTTTTGG + Intronic
1179147091 21:38777517-38777539 TTCTTCTTCTGATGTTGCCCAGG - Intergenic
1180056061 21:45359778-45359800 GGCTTGTTCTGAGGTTCACCAGG + Intergenic
1181339183 22:22164942-22164964 GTCTTTTTCTGAGGGTCCCTAGG + Intergenic
1181623195 22:24104729-24104751 TTCTTTTCCTGTGGTTGGCCAGG + Intronic
1181733396 22:24863701-24863723 GTTTTTGTCTGAGCTTGTGCAGG + Intronic
1183937550 22:41272017-41272039 TTCTTCCTCAGAGGTTGTCCTGG - Intronic
1184225392 22:43126800-43126822 GTATTTTCCTGAGGTTTCCCAGG + Intronic
1184580111 22:45411610-45411632 GTCTTGTTCTGTTGTTGCCCAGG + Intronic
951643159 3:24858677-24858699 GTCTTTTTATGATGATGTTCAGG - Intergenic
953763241 3:45711114-45711136 GTCTTTGCCTGAGGTTGTCAGGG + Intronic
953849240 3:46453508-46453530 GTCTCTTTCTCTGGTGGTCCTGG + Intronic
956719931 3:72108823-72108845 GCCTTTTTTTTAGGTTCTCCAGG - Intergenic
963163308 3:142174836-142174858 GTCTTTTTCTTCGGGTTTCCTGG - Intronic
965631058 3:170733257-170733279 CACTTTCTCTGAGGTAGTCCAGG + Intronic
966731734 3:183157162-183157184 GTCTTTTTATAAGGTTATCAAGG - Intronic
969372231 4:6740462-6740484 CAATTTTTCTGTGGTTGTCCTGG + Intergenic
969641606 4:8402130-8402152 GTCTTTCCCTCAGGCTGTCCTGG - Intronic
973973820 4:56242600-56242622 GTCTTTTTCTGAGCTTTTCAGGG - Intronic
975960357 4:79896889-79896911 CTCTTTTTTTGTTGTTGTCCAGG + Intergenic
976567801 4:86571904-86571926 GTCTTTTTTTCAGTTTGTCATGG + Intronic
977528295 4:98170687-98170709 GTGTGTTGCTGAGATTGTCCAGG - Intergenic
977753874 4:100642193-100642215 GTGTTTTTCTGAATTGGTCCTGG - Intronic
979428427 4:120596746-120596768 GTCTTGTCCTGAGATTTTCCAGG - Intergenic
981011892 4:139933561-139933583 GTCTTTTTCTGGGCTTCTCAAGG + Intronic
983151191 4:164283456-164283478 GTCTTTTTTTCAGTTTTTCCAGG - Intronic
983176334 4:164592532-164592554 ATCTTTTTCTTTGGTTGTCATGG + Intergenic
985000439 4:185477223-185477245 GGCTTTTTCTGATGTTTTCTGGG + Intergenic
985959319 5:3287776-3287798 GTCCTTATCTGGGGTAGTCCTGG - Intergenic
987396481 5:17429691-17429713 GGCTTTTTCAGAGGTCGTGCCGG + Intergenic
987851427 5:23360870-23360892 GTCTTTTTCTCCGGTTCTCCTGG - Intergenic
988167422 5:27612138-27612160 GTCTTGTACTGAGTTTGTCATGG + Intergenic
992299296 5:75361924-75361946 GACTTTTTCTGAGCTTTTCATGG + Exonic
992896367 5:81248622-81248644 GTCATTTCTTGAAGTTGTCCTGG - Intronic
994262554 5:97677460-97677482 CTTTTTCCCTGAGGTTGTCCTGG + Intergenic
994572494 5:101532106-101532128 TTTTTTTTCTGAGGCTGTCGGGG - Intergenic
996993770 5:129669154-129669176 GTCTTTTTCTCCGGTGGTGCTGG + Intronic
997248897 5:132373845-132373867 GGTTGTTTCTGAGGTTGTCTGGG + Intronic
1001200096 5:169708104-169708126 GTCATTTTCTGTGCTTGTGCAGG - Intronic
1004495806 6:16161393-16161415 TACTTGGTCTGAGGTTGTCCGGG - Intergenic
1005808922 6:29501614-29501636 ATTTTTTTCTCACGTTGTCCTGG - Intergenic
1008280310 6:49588543-49588565 GTTTTTCTCTGAAGTTCTCCAGG + Intergenic
1008364572 6:50662350-50662372 TCCTTTTTCTCAGGTTGTCAGGG + Intergenic
1012708897 6:102572105-102572127 TTCTTTCTCTAAGGTTTTCCTGG - Intergenic
1012920335 6:105215957-105215979 GTATTTTTGTGAGGTAGTGCCGG + Intergenic
1015116221 6:129652170-129652192 GTCTGTTTCTGAAGTTCTCCAGG + Intronic
1015560670 6:134511723-134511745 AACTTTTTCTTAGGTTTTCCAGG - Intergenic
1016275116 6:142340886-142340908 ATCATTTTCTGTGGTTGTCTTGG + Intronic
1016678703 6:146803260-146803282 GTTTTTTTCTGAGGTTTCTCAGG - Intronic
1017038798 6:150290867-150290889 GTGTTTTTGTGTGTTTGTCCGGG + Intergenic
1019953287 7:4390744-4390766 GTCTTGTTCTCAGCTTGTGCAGG + Intergenic
1021137236 7:16980206-16980228 CTCTTTTTCTGAGATTGTTGAGG + Intergenic
1025019751 7:55471823-55471845 GTCTCTCTCTGAGGTTGTGTTGG - Exonic
1025536169 7:61950421-61950443 GTTTTTGTCTGAGGTTATTCAGG + Intergenic
1027506567 7:79022872-79022894 GTCTGTTCCTGAGCTTGTTCTGG - Intronic
1028341242 7:89722389-89722411 GTCTTTTTCTGACATAATCCAGG + Intergenic
1030653993 7:112146218-112146240 GCCTTTTTCTAAGGTTGGCATGG + Intronic
1031433807 7:121708217-121708239 GTCTTTTTGTTATGTTGCCCAGG - Intergenic
1031503672 7:122553878-122553900 GTGTTATTCTGAGGAAGTCCTGG + Intronic
1032029511 7:128470845-128470867 GTATTTTTCTGTGGTTCTCAAGG + Intergenic
1034908414 7:154971579-154971601 TTCTTTTTCTTACGTTCTCCAGG - Intronic
1035951354 8:4025039-4025061 GTATTAGTCTGATGTTGTCCCGG - Intronic
1038255101 8:25943726-25943748 GTATTTTTCTGGGGTTGTCAAGG - Intronic
1044899375 8:96927576-96927598 GTCATTTAATGAGGTAGTCCTGG + Intronic
1047878473 8:129166831-129166853 CTGTTTTTCTGATGTTCTCCTGG + Intergenic
1048014407 8:130484522-130484544 GTCTCTCTCTGGGGTTGTTCTGG - Intergenic
1048155091 8:131939869-131939891 GCCTTCATCTGAGTTTGTCCTGG + Intronic
1048432879 8:134386698-134386720 TTCTATTTCTGAGGCTGCCCAGG - Intergenic
1049254504 8:141606488-141606510 TTCCTTTCCTGAGGGTGTCCAGG + Intergenic
1049931538 9:461881-461903 GTCCTTTTCTGAACTTTTCCTGG + Intronic
1051676551 9:19564045-19564067 GTGTTTTTGTGATGTTGCCCAGG + Intronic
1054961336 9:70973486-70973508 TTTTTTTTCTGAGTTTGTCTAGG + Intronic
1055794151 9:79955880-79955902 GGCTTTTTTTGAGTTTGCCCAGG - Intergenic
1056484250 9:87038897-87038919 TTCTTTTTGTCAGGTTGTCCTGG + Intergenic
1057157293 9:92854075-92854097 GCTTTTTTCTCAGTTTGTCCAGG + Intronic
1057391345 9:94643639-94643661 GTGTTTTCCTTATGTTGTCCAGG - Intergenic
1186609167 X:11122098-11122120 CTCTTTTTCAGAGGTTGTTCAGG - Exonic
1187107591 X:16260253-16260275 GATGTTTTCTGAGGTTTTCCAGG - Intergenic
1187234504 X:17454405-17454427 GGCTACTTCTGAGGTTCTCCCGG + Intronic
1187427677 X:19193116-19193138 TTCTTTTTCTTAAGTTCTCCAGG - Intergenic
1188024735 X:25196211-25196233 GAATTTTTCTGACCTTGTCCTGG + Intergenic
1189381653 X:40506654-40506676 CTCTGTTTCAGAGGTTGCCCAGG - Intergenic
1190163717 X:48054060-48054082 GTTTTTTTCTGAGGCTGTTAGGG - Intronic
1191062873 X:56318196-56318218 GTCTGTTCCTGGGGTTGGCCAGG - Intergenic
1193370085 X:80685452-80685474 ATCTCTTTCTGAGGTAGGCCTGG - Exonic
1195752700 X:108174307-108174329 AACTCTTTCTGAGGATGTCCTGG + Intronic
1199022322 X:142896493-142896515 GTTTTTATTTGAGGTTCTCCAGG - Intergenic
1199590240 X:149461023-149461045 TTCTGTTTCTGTGGTTGTTCTGG + Intergenic
1200982918 Y:9278622-9278644 ATATTTTCCTGAGGTTGCCCTGG + Intergenic
1202127458 Y:21581087-21581109 ATATTTTCCTGAGGTTGCCCTGG - Intergenic
1202151803 Y:21850444-21850466 ATATTTTCCTGAGGTTGCCCTGG + Intergenic