ID: 1125156431

View in Genome Browser
Species Human (GRCh38)
Location 15:36591989-36592011
Sequence ACTGGATGGCTGGCATAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125156431_1125156437 -5 Left 1125156431 15:36591989-36592011 CCACTTTATGCCAGCCATCCAGT 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1125156437 15:36592007-36592029 CCAGTGCCATGCAGGAATGTGGG 0: 1
1: 0
2: 4
3: 14
4: 193
1125156431_1125156438 0 Left 1125156431 15:36591989-36592011 CCACTTTATGCCAGCCATCCAGT 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1125156438 15:36592012-36592034 GCCATGCAGGAATGTGGGCCTGG 0: 1
1: 1
2: 5
3: 28
4: 250
1125156431_1125156435 -6 Left 1125156431 15:36591989-36592011 CCACTTTATGCCAGCCATCCAGT 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1125156435 15:36592006-36592028 TCCAGTGCCATGCAGGAATGTGG 0: 1
1: 0
2: 1
3: 18
4: 207
1125156431_1125156440 10 Left 1125156431 15:36591989-36592011 CCACTTTATGCCAGCCATCCAGT 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1125156440 15:36592022-36592044 AATGTGGGCCTGGTGCTGCCAGG 0: 1
1: 0
2: 4
3: 34
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125156431 Original CRISPR ACTGGATGGCTGGCATAAAG TGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
907425835 1:54378794-54378816 GCTGGAGGGCTGGGACAAAGGGG + Intronic
908754929 1:67460902-67460924 ACTAGAGGGCTGGGAGAAAGAGG + Intergenic
909620481 1:77661696-77661718 ATGGAATGTCTGGCATAAAGTGG + Intronic
919242116 1:194927604-194927626 ACTGGATGTCTATCATAAACTGG + Intergenic
921168469 1:212524957-212524979 ACTGGATGGCTGGGATAAATAGG + Intergenic
921328656 1:214013648-214013670 AGGGGATGGCTGGCATCAGGAGG + Intronic
923519173 1:234722737-234722759 ACTGGATGGCTGCCTTCACGTGG - Intergenic
924501028 1:244638201-244638223 ACTGGATGGATCGGAGAAAGAGG - Intronic
1065878444 10:30018403-30018425 ACTGCTTGGCTGGCAGAGAGAGG + Intronic
1066308795 10:34174564-34174586 CCTGTCTGGCTGGCATAAAAGGG + Intronic
1069085037 10:64129166-64129188 ACAGGATAGCTGGGATAAAGAGG + Intergenic
1072447834 10:95515053-95515075 ACTGGGTAGCTGGAGTAAAGTGG + Intronic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1076567091 10:131406318-131406340 ACTGATTGGTTGGCAGAAAGTGG + Intergenic
1077680724 11:4237768-4237790 ACCGGATGGCTGCCAGGAAGAGG - Intergenic
1077685007 11:4283166-4283188 ACCGGATGGCTGCCAGGAAGAGG - Intergenic
1077690183 11:4334764-4334786 ACCGGATGGCTGCCAGGAAGAGG + Intergenic
1077924035 11:6662879-6662901 AGTGAATGGCTGACATGAAGGGG + Intergenic
1081023953 11:37984860-37984882 ACTGGATGGCTGGCTGAAGAAGG - Intergenic
1084935990 11:72586885-72586907 ACTGGATGGCAAGCATGAATGGG - Intronic
1086094821 11:83039903-83039925 ACTGGATGAATGGGTTAAAGAGG + Intronic
1087161853 11:94956671-94956693 ACTGGATGGCTGGAAAAGAGAGG + Intergenic
1089520613 11:119060507-119060529 ACTGGATAGTTGGCCAAAAGTGG - Intergenic
1090851026 11:130570738-130570760 ACTGGCTTGGTGGCATAGAGGGG + Intergenic
1091139795 11:133225024-133225046 ACTTCATGGCTGTCATAATGAGG - Intronic
1092082909 12:5732920-5732942 ACTGGATGGCTGATACGAAGAGG + Intronic
1097350844 12:58547050-58547072 GCTGGAGGGCTGGGATAGAGAGG + Intronic
1101654686 12:106709363-106709385 ACTGGATGAGTGGCTAAAAGTGG + Exonic
1102681029 12:114690830-114690852 GCTGGGTGGCTGGCAAGAAGTGG - Intergenic
1103213819 12:119186611-119186633 ACTGGATGGCAGGCTTGAAGCGG - Intronic
1105612239 13:21978401-21978423 ACTGCATGTCAGGCACAAAGGGG - Intergenic
1106295734 13:28412151-28412173 ACAGGATGGCCGCCATAATGGGG - Intronic
1107271486 13:38623522-38623544 ACTGGATGGTAGGTATAAAGAGG + Intergenic
1114174728 14:20309903-20309925 ACGGGATGGCTGCCAGGAAGAGG - Intergenic
1114838487 14:26233381-26233403 AATGAGTGGCTGTCATAAAGAGG + Intergenic
1116828376 14:49693532-49693554 ACTGAATTGCTGGCAAAGAGGGG - Intronic
1121990892 14:98556180-98556202 CCTGGAGGGCTGGCTGAAAGAGG + Intergenic
1125156431 15:36591989-36592011 ACTGGATGGCTGGCATAAAGTGG - Intronic
1125378569 15:39060847-39060869 ACTGGATGCCTAGCAAATAGAGG - Intergenic
1128221290 15:65970451-65970473 ACTGGAAGGCTGGCAGAGAGAGG + Intronic
1130270207 15:82442242-82442264 ACTGGATTGCTGACAGATAGAGG + Intergenic
1130275761 15:82475587-82475609 ACTGGATTGCTGACAGATAGAGG - Intergenic
1130282840 15:82532679-82532701 ACTGGATTGCTGACAGATAGAGG + Intergenic
1130462548 15:84169563-84169585 ACTGGATTGCTGACAGATAGAGG + Intergenic
1130468123 15:84202979-84203001 ACTGGATTGCTGACAGATAGAGG - Intergenic
1130490129 15:84425230-84425252 ACTGGATTGCTGACAGATAGAGG - Intergenic
1130496143 15:84470563-84470585 ACTGGATTGCTGACAGATAGAGG + Intergenic
1130501716 15:84503980-84504002 ACTGGATTGCTGACAGATAGAGG - Intergenic
1130590416 15:85207577-85207599 ACTGGATTGCTGACAGATAGAGG - Intergenic
1130701572 15:86188187-86188209 ACTGTATGGTTGACAAAAAGGGG + Intronic
1132677162 16:1125574-1125596 ACTGGATGGCTGGGAGAGGGAGG - Intergenic
1133708019 16:8374007-8374029 ACTGGGTTGCTGGCATCAATGGG - Intergenic
1141758920 16:86014158-86014180 ACTGGAGAGCTGGCTTAAAAAGG - Intergenic
1150598335 17:66626968-66626990 ACATGGTGGCTGGAATAAAGGGG - Intronic
1157809888 18:50687534-50687556 ACTTGCTGGGTGGCACAAAGAGG - Intronic
1160134495 18:76261002-76261024 ACTGTATTTCTGGCACAAAGGGG + Intergenic
1161551067 19:4912476-4912498 GCTCGGTGGCTGGCATAGAGTGG - Intronic
1162622901 19:11858664-11858686 ACTGGATGCAGGCCATAAAGAGG - Intronic
924982932 2:239713-239735 ACTGCAGTGGTGGCATAAAGAGG + Intronic
926273744 2:11387860-11387882 ACTAGATGCCTGGCACACAGTGG + Intergenic
927324809 2:21791838-21791860 ACTAAATGGGTGGCATGAAGTGG + Intergenic
927428864 2:23009508-23009530 ATTGGATGGCTGGGATAACTGGG - Intergenic
940368326 2:152873395-152873417 CCTGAAAGGCTGGCATATAGTGG + Intergenic
943145932 2:184044810-184044832 AGTGGAGGGCTGGCATGGAGGGG + Intergenic
943473792 2:188329518-188329540 ACTGGGTGGCTGAAATGAAGTGG + Intronic
947689262 2:232119810-232119832 ACTGCATGGCCAGCTTAAAGAGG + Intronic
948018262 2:234708215-234708237 ACTTGATGGCTGGCATTACTGGG - Intergenic
1174119569 20:48252556-48252578 TGTGGATGGCTGGCATCTAGTGG - Intergenic
950179255 3:10899668-10899690 CCTGGAAGGCTGGCAGAAAGTGG - Intronic
950624895 3:14238023-14238045 ACTGGAGGGCTGTCAGGAAGGGG - Intergenic
955659182 3:61278233-61278255 ACTGGGTGCCTAGCATAAAAAGG - Intergenic
956908029 3:73787210-73787232 ACTGAATGCCTGGCAGAAAGAGG + Intergenic
956926990 3:74000425-74000447 ACTGCATTACTGGCATAAATTGG + Intergenic
958737332 3:98024317-98024339 GCTGGATTGCTGGCATGCAGTGG - Intronic
959246702 3:103879833-103879855 ACTGGATGCATGGCATAAACAGG + Intergenic
959499867 3:107093643-107093665 ACTGGCTGCCTGGCTAAAAGTGG - Intergenic
960993161 3:123324779-123324801 ACTGGAAGGCTGGCATTAGTGGG + Intronic
961592291 3:127990118-127990140 AGTGGACAGCTGGCACAAAGAGG + Intergenic
962377411 3:134870096-134870118 TTTGGATGGCTGGCATAGATGGG + Intronic
962428533 3:135297720-135297742 CTTGGATGGCAGGCATAAGGTGG + Intergenic
963068604 3:141283311-141283333 ACTGGCTTGCTGGGAAAAAGAGG + Intronic
968275747 3:197438976-197438998 ACTGGATGTCAGGCATATGGAGG - Intergenic
969552111 4:7876959-7876981 GCTGGAAGGCTGGAAGAAAGAGG - Intronic
972226670 4:37021289-37021311 ACTGGGTGGCTGCCATAATTTGG - Intergenic
975148009 4:70991693-70991715 CCTGGATGGATGTCATAAAGAGG - Intronic
975371317 4:73591822-73591844 ACTGTGTGCCTGGCACAAAGAGG - Intronic
975689041 4:76948024-76948046 ACTGTATGTTTGGCATAAAATGG + Intergenic
975697180 4:77024708-77024730 ACTGCATGGCTGGTGTACAGAGG - Intronic
975859910 4:78665783-78665805 AAAGGATGGATGGCAGAAAGGGG - Intergenic
978768544 4:112430217-112430239 AGTGACTGGCTGGCATGAAGGGG - Intronic
978834540 4:113132961-113132983 GCTGGAGGGCTGCCATGAAGAGG - Intronic
979431553 4:120638869-120638891 ACTCGATGGCTGGAATCATGTGG + Intergenic
980632699 4:135456635-135456657 ACAGGATGGCTGACATGAGGTGG - Intergenic
981477717 4:145204597-145204619 ACTGGGTGACTGACATACAGAGG + Intergenic
983557498 4:169071494-169071516 ACTGGATGGCCAGCATCCAGGGG - Intergenic
986880942 5:12170543-12170565 AATGGATGGCTGAAAGAAAGGGG - Intergenic
988793758 5:34633404-34633426 TCTGAATAACTGGCATAAAGTGG - Intergenic
993969379 5:94398087-94398109 ACTGGATGTCAGAGATAAAGGGG - Intronic
996833178 5:127762448-127762470 ACTGGGTTGTTGGCATAAATTGG + Intergenic
998810989 5:145965697-145965719 TCTGGCTGGCTGGCATATGGTGG - Intronic
1004559616 6:16735277-16735299 AATGGCTGGCTGGCATATTGAGG - Intronic
1006503362 6:34472455-34472477 ACAGAATGGCTGAAATAAAGAGG - Intronic
1006606026 6:35258710-35258732 ACTGGGTGGCTGGAAGAATGAGG - Intergenic
1009420668 6:63460954-63460976 ACTGAATGTCTGGCATGAGGGGG + Intergenic
1010985093 6:82414509-82414531 AGAGGATGGATGGCCTAAAGAGG + Intergenic
1012109573 6:95212147-95212169 AGTGGATGGCTGGCTTAAACTGG - Intergenic
1015634014 6:135258280-135258302 ACTGCATGCCTGCCATAATGTGG + Intergenic
1016624302 6:146147672-146147694 ACAGGATGGCTGGCTCATAGAGG - Intronic
1016793829 6:148096174-148096196 GCTGGATGGCAGGCATAATTTGG + Intergenic
1017784751 6:157746420-157746442 ACAGGATGCTGGGCATAAAGTGG + Intronic
1020038559 7:4982647-4982669 ACAGGAGGTCTGGCAGAAAGAGG - Intergenic
1020156744 7:5731817-5731839 ACAGGAGGTCTGGCAGAAAGAGG + Intronic
1020278677 7:6638867-6638889 ACTGGCAGGCTGGCAAGAAGAGG + Intronic
1020431587 7:8121262-8121284 GCTGGATGGCAGGCAAGAAGTGG - Intronic
1022063139 7:26821797-26821819 ACTTGATGGGTGGGACAAAGGGG - Intronic
1025245027 7:57310402-57310424 AATGGATGGATGGGATAAATGGG - Intergenic
1027947764 7:84771108-84771130 ACTGGATGGCTAACAAAAACCGG + Intergenic
1030198180 7:106874154-106874176 ACTGGATGACTGACAGAATGAGG - Intronic
1030434700 7:109502041-109502063 ACTATATGGCTGCCATAAAGTGG - Intergenic
1031288464 7:119901580-119901602 AGTGGATGTGTGGCATGAAGAGG - Intergenic
1031809382 7:126346918-126346940 CCTGGATGGCTTGAATAACGTGG + Intergenic
1031979886 7:128117713-128117735 CTGGGATGGCTGGCATACAGAGG - Intergenic
1034293201 7:149948529-149948551 ACTGGAGGGCTGGGATGGAGAGG - Intergenic
1034812873 7:154148350-154148372 ACTGGAGGGCTGGGATGGAGAGG + Intronic
1037724494 8:21472226-21472248 ACTGGATTGCTGAGATAAACAGG + Intergenic
1038184106 8:25257248-25257270 GCTCGATGCCTGGCATAGAGAGG - Intronic
1039373199 8:37007751-37007773 GCTGGATGGATAGAATAAAGTGG + Intergenic
1043595744 8:81882627-81882649 TCTGGATAACTAGCATAAAGTGG - Intergenic
1044583290 8:93843696-93843718 ACTGTAGGGGTGGTATAAAGTGG + Intergenic
1047194635 8:122710535-122710557 ACTGGATGGCTGGGGAACAGGGG - Intergenic
1047340011 8:123971930-123971952 ACTGGATGGATGACTTTAAGAGG + Intronic
1047899971 8:129409959-129409981 ACTGGATGGTTGTCATAGAAAGG + Intergenic
1048706890 8:137163733-137163755 ACTGAATCCCTGGCATATAGAGG - Intergenic
1052021082 9:23525915-23525937 AATGGTTGCCTAGCATAAAGAGG + Intergenic
1052270902 9:26626957-26626979 AAAAGATGGCAGGCATAAAGAGG - Intergenic
1052517405 9:29501247-29501269 TCTAAATGGCTGTCATAAAGAGG + Intergenic
1055026358 9:71726519-71726541 ACTGTATACCTGGCATATAGTGG - Intronic
1055299812 9:74871265-74871287 ACTGGATGGCTGGGGAACAGGGG - Intronic
1057406494 9:94776100-94776122 ACTGGATGTCTGGGAAATAGAGG - Intronic
1057722542 9:97544602-97544624 ACTGTATGCCTGGCACATAGAGG - Intronic
1059562688 9:115350751-115350773 AAAGGATGGCTGGCATGCAGTGG - Intronic
1061061655 9:128253660-128253682 ACTGGATTGCCGGCAGATAGAGG - Intronic
1061517394 9:131097589-131097611 ACTGGATGCCTGGCAACAACAGG - Intronic
1061541711 9:131280989-131281011 GCTGGATGACTGGGATATAGTGG + Intergenic
1062109485 9:134774155-134774177 ACAGGATGCCTGGCACATAGAGG - Intronic
1190165317 X:48068740-48068762 ACTGGGTGGTGGGCATAATGGGG + Intronic
1190725284 X:53186217-53186239 ACAGTATAGATGGCATAAAGGGG + Intergenic
1190898536 X:54645741-54645763 GATGGATGGCTGGCATTCAGTGG - Intergenic
1195229890 X:102835692-102835714 ACTGGCTGGAAGGCATAACGTGG - Intergenic
1198521856 X:137461102-137461124 ACTGAATGGATGTTATAAAGTGG + Intergenic
1201228491 Y:11840836-11840858 ACTGGATCACTGGCATCTAGTGG + Intergenic
1201616643 Y:15907915-15907937 AGTGGGTGGGTGGGATAAAGGGG + Intergenic
1202368100 Y:24180344-24180366 ACTGGATTGCTGACAGATAGAGG + Intergenic
1202502685 Y:25489773-25489795 ACTGGATTGCTGACAGATAGAGG - Intergenic