ID: 1125157134

View in Genome Browser
Species Human (GRCh38)
Location 15:36600561-36600583
Sequence TCATTGATATGGTGATTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125157130_1125157134 22 Left 1125157130 15:36600516-36600538 CCATGATCAATCAAATAAACTAG 0: 1
1: 0
2: 1
3: 7
4: 163
Right 1125157134 15:36600561-36600583 TCATTGATATGGTGATTAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125157134 Original CRISPR TCATTGATATGGTGATTAGG TGG Intronic
906343675 1:45002300-45002322 GCATGGATATGGTGATTTGGAGG - Intergenic
906559882 1:46748670-46748692 TCATTAATATGATTATTATGGGG - Intergenic
908696784 1:66852764-66852786 CCAATGTAATGGTGATTAGGAGG + Intronic
908873580 1:68643676-68643698 TCTTTGCTATTGTGAATAGGTGG + Intergenic
910758498 1:90714238-90714260 TCATTGATTTGGGGATGAAGTGG + Intronic
911268859 1:95776127-95776149 GCATTGATGTTGTGATTAGGTGG + Intergenic
915907776 1:159891455-159891477 TCATTGAGTTGGTGGTGAGGAGG + Intronic
916010790 1:160703736-160703758 TCATTTATAAGGTGATAAGTAGG + Intronic
917780587 1:178391876-178391898 TCATTGCTATGGTGAGCAGTAGG + Intronic
921985720 1:221309792-221309814 TCAATGAGATACTGATTAGGTGG + Intergenic
1062869059 10:882924-882946 GCATTGGTTTAGTGATTAGGTGG - Intronic
1068062687 10:52088878-52088900 TTATTGATTTTCTGATTAGGAGG - Intronic
1069234480 10:66053257-66053279 TCTTTGAGATGGTGATTGGTAGG - Intronic
1073721577 10:106178758-106178780 AGATAGATATGGTGATTATGTGG - Intergenic
1075342440 10:121658153-121658175 TCTTTGCTATTGTGAATAGGAGG - Intergenic
1080963682 11:37189541-37189563 ACATTGGTATAGTTATTAGGAGG + Intergenic
1081494311 11:43591906-43591928 TCATTAATATGTTTATTTGGGGG + Intronic
1087884398 11:103460626-103460648 TCATTGACATGTTTATTATGAGG + Intronic
1088689005 11:112309199-112309221 TCATTCACATGGTTATTAGCAGG + Intergenic
1089041649 11:115456791-115456813 ACATTGATATGGTGTTTTTGAGG - Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1090936208 11:131344819-131344841 TCATTGATAAGGTGCTGAGTGGG - Intergenic
1093042871 12:14404833-14404855 TATTTGATATGATGATTAGGAGG + Intronic
1098579012 12:72076633-72076655 TCATTCACAGGGTGGTTAGGAGG - Intronic
1099730537 12:86494051-86494073 TGATTGTTATGGTGATTACATGG - Intronic
1099741548 12:86642123-86642145 TAATTGATATGGAGATAAGAAGG + Intronic
1100448165 12:94680171-94680193 TCATTCATAAGGTGACTAGGAGG + Intergenic
1100493707 12:95105121-95105143 TCATTGATATGGTTTTCAGTAGG - Intronic
1108833931 13:54516756-54516778 TCAATGATATATTGATTATGGGG + Intergenic
1110013809 13:70373674-70373696 TCATTTATATGGAGATAATGAGG + Intergenic
1110453540 13:75664164-75664186 TCATTGAGATAGAGATTAGAAGG - Intronic
1110808489 13:79786596-79786618 TCATAGATATGTTCATTAGTAGG - Intergenic
1111033770 13:82642541-82642563 TGCTAGATATGCTGATTAGGTGG - Intergenic
1112776874 13:102853611-102853633 ACACTGATATGGCAATTAGGAGG + Intronic
1115740151 14:36378966-36378988 TTATTGATCTGGTGGTCAGGAGG + Intergenic
1116919587 14:50559209-50559231 TCATGGATCTGGTAATTAAGAGG + Intronic
1116984222 14:51203088-51203110 TCCTAGAGATGGTGCTTAGGAGG + Intergenic
1120743651 14:88134478-88134500 ACAAGGATATGGTGAGTAGGAGG + Intergenic
1123951013 15:25274686-25274708 ACATTTAAAAGGTGATTAGGCGG - Intergenic
1124712530 15:32027896-32027918 TCATGGATATTGCGATTTGGGGG + Intergenic
1125157134 15:36600561-36600583 TCATTGATATGGTGATTAGGTGG + Intronic
1127460591 15:59194953-59194975 TCATCAATACGGTGCTTAGGGGG + Intronic
1127663956 15:61126322-61126344 TGATGGATATGTTGATTAGCTGG - Intronic
1130699115 15:86161288-86161310 TCATTGGCATGGTGTTTATGAGG + Intronic
1131770023 15:95727207-95727229 TCATTAATAGAGTGAATAGGAGG + Intergenic
1132189322 15:99837004-99837026 TCATTTATACCGTAATTAGGAGG + Intergenic
1133559306 16:6935674-6935696 TTATTCAAAGGGTGATTAGGAGG + Intronic
1135336563 16:21606477-21606499 ACATTGATATGATGGTTGGGTGG - Intronic
1135560983 16:23476793-23476815 TCAATTATATGGTTATTAGAAGG + Intronic
1137571685 16:49570451-49570473 TCATTTATATGGTGAGTTGGGGG + Intronic
1141265846 16:82496222-82496244 TCATTAATATGTTCATTAGCAGG - Intergenic
1143368888 17:6426125-6426147 TCCCTCATATGGTGATTATGAGG + Intronic
1148236927 17:45975200-45975222 CCATTGGTTTGGTGATTTGGAGG + Intronic
1149293842 17:55242859-55242881 TCAATCATATGGTGAATAGATGG - Intergenic
1150687001 17:67328940-67328962 TTATTGGTCTGGTGATTAGGAGG + Intergenic
1150934859 17:69624149-69624171 TGATTGATTTGGTGATTAGCTGG + Intergenic
1154174610 18:12077159-12077181 TCATTGCTATGTTAATTTGGGGG + Intergenic
1154306260 18:13232978-13233000 TCATTGTTAAAATGATTAGGTGG + Intronic
1156307632 18:35893334-35893356 TCATGGAAATGGTGATGATGTGG + Intergenic
1159459873 18:68711591-68711613 TCAATGATAAAGTAATTAGGAGG + Intronic
1165961201 19:39535863-39535885 TTATTTAACTGGTGATTAGGTGG + Intergenic
926177957 2:10613778-10613800 TACTTGATATGGTTGTTAGGTGG - Intronic
926877660 2:17501034-17501056 TCATTATTATGGAGATTTGGGGG - Intergenic
928909040 2:36400179-36400201 TCAGTGATATGGAGAGTAGAGGG + Intronic
934919940 2:98334823-98334845 CCTTTGATATGATGATGAGGTGG - Intronic
935480911 2:103588258-103588280 GCAATGATTTGGTGATTATGTGG - Intergenic
940091818 2:149928327-149928349 TCATTCCTGTGGTGATTTGGAGG + Intergenic
940938763 2:159531695-159531717 TCATTGATATTCTGACTTGGAGG - Intronic
941393567 2:164946831-164946853 TCACTGATATGGGAATCAGGGGG - Intronic
942871690 2:180742162-180742184 TAATTGAAATGGGGATGAGGAGG - Intergenic
944383105 2:199134583-199134605 TCATTAATATGGAGATAAGTGGG - Intergenic
945045078 2:205774716-205774738 TCTTTGATCTGGGGAATAGGTGG - Intronic
945697978 2:213132784-213132806 TAATTGAAATGGTAATTAAGTGG - Intronic
948026719 2:234784246-234784268 TGGTTGCTATGGTGATTAGATGG - Intergenic
1175504223 20:59470479-59470501 TCATGGTTCTGGGGATTAGGGGG + Intergenic
1181739586 22:24910214-24910236 TCATTGATATAGGGATTTTGGGG + Intronic
1182674306 22:32026052-32026074 TGATTGAGATGGTGGTTATGTGG + Intergenic
950200901 3:11043051-11043073 TCCTTGCTATGTTGCTTAGGTGG - Intergenic
950210012 3:11116355-11116377 TCATGGAAATGGTGACTGGGAGG - Intergenic
950602272 3:14045388-14045410 TCAGAGATATGGTAATTAGAGGG - Intronic
953504608 3:43472413-43472435 TCACTGATATGGTGGGTAGGGGG + Intronic
955105721 3:55895894-55895916 TCTTTGCTATGGGGATGAGGGGG + Intronic
961319279 3:126061679-126061701 TCATTGATGAGGTGAAGAGGAGG + Intronic
962134196 3:132716558-132716580 TAATTCATATGGTGATCAGATGG - Intronic
963928366 3:150976015-150976037 ATATTCATATGGTGATTTGGGGG - Intergenic
966423525 3:179757224-179757246 TCAGTGACATGCTGATCAGGTGG + Intronic
972242427 4:37207676-37207698 TCATGGAGATAGTGATTAGAAGG - Intergenic
972727360 4:41756730-41756752 TCATTGATTTGGTGGAGAGGGGG + Intergenic
972959685 4:44437920-44437942 TCATTTATATGGTGGTTTTGGGG - Intronic
977304241 4:95303010-95303032 TCAATCATATGGTGAGCAGGAGG + Intronic
990087037 5:51991773-51991795 TAATTGATATGGTATTTGGGAGG + Intergenic
990400509 5:55432962-55432984 TCACTGCTATGCTGAATAGGAGG - Intronic
991244121 5:64490608-64490630 TCATTGCTGTGGTTATTTGGAGG - Intergenic
996485180 5:124025423-124025445 TCATGAATAAGGTGATTATGTGG + Intergenic
997652491 5:135532956-135532978 TCATGAATATAGTGATTTGGTGG - Intergenic
997831559 5:137155045-137155067 TCCCTGATATGGTGGTCAGGAGG + Intronic
1002698382 5:181105185-181105207 TCTGGGAAATGGTGATTAGGTGG - Intergenic
1002708516 5:181179723-181179745 TCTGGGAAATGGTGATTAGGTGG + Intergenic
1008515121 6:52311594-52311616 TCATAGATATGGGGATTAATGGG + Intergenic
1009987312 6:70796027-70796049 TCATTAATATGTTGAGAAGGAGG - Intronic
1010090647 6:71976931-71976953 TCTTTGATATTGTGAATAGTTGG + Intronic
1010330389 6:74616740-74616762 TCTTTGCTATTGTGAATAGGAGG + Intergenic
1011325611 6:86147811-86147833 TCATTGTCTTGGTGATCAGGTGG + Intergenic
1011327130 6:86161124-86161146 TCACTGATCTGATGATTATGGGG + Intergenic
1012762427 6:103318608-103318630 TCCTTGACATGGGGATTATGGGG - Intergenic
1014102600 6:117528272-117528294 TTATTGACATGGTAATTAGGAGG + Intronic
1014892084 6:126855106-126855128 TCCTGGATTTGGTGATTAGAAGG - Intergenic
1014902988 6:126990603-126990625 TCATTGATGTTGTGCTTTGGGGG - Intergenic
1015292416 6:131552457-131552479 TCAATCATATGGCAATTAGGAGG + Intergenic
1016910246 6:149191892-149191914 TCATTGACATGGTGATTACATGG + Intergenic
1017282052 6:152636440-152636462 TCATAGATAAGGAGACTAGGAGG - Intronic
1018233287 6:161696951-161696973 TCATTGAAATGGTGATTGCCTGG + Intronic
1019148965 6:169991888-169991910 TCCTTGCTGTGGTGTTTAGGGGG + Intergenic
1025008029 7:55370135-55370157 TCATTCACATGGTGGTTAGTCGG + Intronic
1026651078 7:72216453-72216475 TCATAGGTCTGGGGATTAGGAGG + Intronic
1028233985 7:88338117-88338139 TAATTTATATGGTTGTTAGGAGG + Intergenic
1028861869 7:95661311-95661333 TCATTCATATGGTGATTGGCAGG + Intergenic
1030818939 7:114073154-114073176 TCAGTGATTTGGTGCTAAGGAGG - Intronic
1031778753 7:125936131-125936153 TCACTGAAAGGGTGATTAAGTGG - Intergenic
1032012100 7:128353403-128353425 TCCTTGAGATGGAGATAAGGTGG - Intronic
1033058497 7:138081996-138082018 TTATTGGTCTGGTGACTAGGAGG + Intronic
1034905625 7:154942772-154942794 GCATTGATTTGGTGACTAAGAGG - Intronic
1036913061 8:12775094-12775116 TCAATGATATGCTAATTAAGAGG - Intergenic
1038578959 8:28730419-28730441 TCATTTATATGAGTATTAGGTGG + Intronic
1041807010 8:61862515-61862537 TTATTGATATGGTAAATATGTGG + Intergenic
1042668569 8:71234427-71234449 TCATTGACATGGTGCTTATCAGG + Intronic
1042753165 8:72180316-72180338 TGATTTATAAAGTGATTAGGAGG - Intergenic
1043109251 8:76157692-76157714 TCACTGATTTGAGGATTAGGAGG + Intergenic
1045066462 8:98451127-98451149 TTGTTGTTATGGTGATTATGTGG + Intronic
1045970396 8:108073361-108073383 TCATTGCTGAGGTGATTAGTTGG + Intronic
1047138670 8:122109935-122109957 TCATGAATATGGTCATTATGTGG - Intergenic
1049522851 8:143103215-143103237 TCCTTGATCAGGTGATTACGAGG - Intergenic
1050960852 9:11728432-11728454 TCATGGATATGTTGATTAAATGG + Intergenic
1051940415 9:22499166-22499188 ACATTAATATGTTGATTAGAGGG + Intergenic
1052794022 9:32905962-32905984 TTACTGATATGGTGATTTGTGGG - Intergenic
1053850410 9:42285013-42285035 TCATTGATAAGGAGATTATCTGG + Intergenic
1055884085 9:81038504-81038526 TCCTTCATAAGGTGATTGGGAGG - Intergenic
1059350477 9:113660756-113660778 TCATTGAATTGGTGATTTGGAGG + Intergenic
1186570500 X:10710185-10710207 TCATTGATGGGGTGGTCAGGAGG + Intronic
1187291724 X:17961079-17961101 TAATTGATAGGCTGATTAGAGGG - Intergenic
1188732893 X:33673858-33673880 ACATTGATTTGGAGATTATGGGG - Intergenic
1191842274 X:65521803-65521825 CCACTGATTTGGTAATTAGGAGG + Intronic
1192980429 X:76334104-76334126 TCATTGAGATAGTGAGTAGAAGG + Intergenic
1193456074 X:81733422-81733444 TAATGGATATGTTAATTAGGTGG + Intergenic
1194755853 X:97738448-97738470 TCCTTGATAAGGTGATGAGATGG + Intergenic
1195671596 X:107474582-107474604 TCATTGGTAGGGGGTTTAGGAGG + Intergenic
1196305182 X:114094023-114094045 TGAATGATTTGGTGATTAAGTGG + Intergenic
1201718683 Y:17074201-17074223 TCATTCATGTGGTGCTTAAGGGG - Intergenic