ID: 1125157908

View in Genome Browser
Species Human (GRCh38)
Location 15:36610117-36610139
Sequence GGGTTCACAAACTATAATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125157908 Original CRISPR GGGTTCACAAACTATAATAT AGG Intronic
907805480 1:57814963-57814985 GGGTTTACAAACTATGATTCAGG + Intronic
909411189 1:75353907-75353929 CGGTTCAAAAACAGTAATATGGG + Intronic
911393176 1:97271604-97271626 GGGTTTTCAAAATATAATATCGG - Intronic
917716388 1:177741945-177741967 AGGTTCTCAATCTATAAGATGGG + Intergenic
922541022 1:226419711-226419733 AGGTTCTCAAACTATAATCAAGG - Intergenic
1067235463 10:44443697-44443719 GAGGTCTCCAACTATAATATTGG - Intergenic
1072027298 10:91473799-91473821 GTGTTAATAAACTATATTATTGG + Intronic
1074480054 10:113811258-113811280 GTGTTCAGAGACTATAATTTAGG - Intergenic
1079912087 11:26323230-26323252 GGTATCAGAAACTAAAATATGGG + Intronic
1081173383 11:39894920-39894942 AGGTTCAGAAATTATAAAATTGG + Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1084562639 11:69913208-69913230 GGGTTCACAAACTTTGAATTTGG + Intergenic
1086820077 11:91425057-91425079 TAGTTAACAAACTAAAATATAGG - Intergenic
1098430905 12:70418957-70418979 GGCTTCACAAAGTAAAATAAGGG + Intronic
1108462588 13:50681925-50681947 GGGATAATAAATTATAATATGGG - Intronic
1110413083 13:75224323-75224345 GGAATCACACACTCTAATATTGG + Intergenic
1110639951 13:77812089-77812111 GGATTCACAAATAATAAAATGGG - Intergenic
1121177705 14:91903602-91903624 GAGTTCACAGACTATGATACAGG - Intronic
1125157908 15:36610117-36610139 GGGTTCACAAACTATAATATAGG + Intronic
1126293678 15:47111927-47111949 TGGTTTTCAAACTGTAATATGGG + Intergenic
1128815690 15:70606479-70606501 GGGTTCAGAAGCTCAAATATAGG - Intergenic
1128949025 15:71855434-71855456 AGGTTAATAAAGTATAATATTGG - Intronic
1133967945 16:10545311-10545333 GGGTCCAAATACTATAATCTAGG + Intronic
1134298013 16:12963757-12963779 GGTTTCACAAAGTATCATACAGG + Intronic
1134375305 16:13666678-13666700 GGTTTCTCAATCTATAATGTAGG + Intergenic
1136642538 16:31578926-31578948 GTGTTCAGAAAATATGATATCGG + Intergenic
1149125951 17:53233074-53233096 GGGTTGTAAAACTATAATACTGG + Intergenic
1150411807 17:64950666-64950688 AGGTTCAGTAACTATAATAGGGG - Intergenic
1150789510 17:68190399-68190421 AGGTTCAGTAACTATAATAGGGG + Intergenic
1155288859 18:24320725-24320747 GTGTTAAAAAATTATAATATAGG + Intronic
1158122760 18:54068269-54068291 AGCTTCACCAACTATAATGTAGG + Intergenic
927879336 2:26679679-26679701 GGGATCTGAAACTATAAAATCGG + Intergenic
928564370 2:32528771-32528793 GGGTACACAAACTTTATTACAGG + Intronic
933362478 2:81305294-81305316 GGGATGAAAAACTTTAATATGGG + Intergenic
940484362 2:154278103-154278125 TGGTTGACCAACTAAAATATAGG - Intronic
943211097 2:184967406-184967428 GGGTTAACATCCAATAATATAGG - Intergenic
943557745 2:189426669-189426691 GGGTTCACAAACTTCAGTAAAGG + Intergenic
946560848 2:220911125-220911147 TAATTCACAAACTATAATATGGG + Intergenic
948313426 2:237007888-237007910 GGGTTAAAAAAATAAAATATGGG - Intergenic
948480236 2:238245160-238245182 TGGTTCAGAAAATTTAATATTGG - Exonic
1169753495 20:9019817-9019839 GAGTTCTCAAAATATAATCTTGG - Intergenic
1172560854 20:35887074-35887096 GGGTACACAAAATATTAAATAGG + Intronic
1181411709 22:22727491-22727513 GAGCTCAGAAACTATAAAATGGG + Intergenic
951697392 3:25459988-25460010 GAGTTCACAAAATATAAGAACGG - Intronic
951822152 3:26825561-26825583 AGGTACACAAGCTATAATACAGG + Intergenic
952305723 3:32144470-32144492 GGAATCACAAACTAAAATAAGGG + Intronic
960133186 3:114079239-114079261 GGGATCAGAAACTATACTATGGG + Intronic
961686842 3:128639023-128639045 GGCTTCACACAATAGAATATTGG + Intronic
963472000 3:145752278-145752300 GTGTGCACAAACTATCATAAAGG - Intergenic
965099262 3:164275755-164275777 GGGTTCACAATATATAAAAGTGG + Intergenic
968021838 3:195398880-195398902 GAGTTGACAGACTAAAATATTGG - Intronic
970910670 4:21271137-21271159 TGGTTCCCAAACTGTATTATTGG - Intronic
971145900 4:23976161-23976183 GGGTGAATAAACTATAATGTGGG + Intergenic
972479305 4:39482859-39482881 TGCTTAACACACTATAATATTGG + Intergenic
975056469 4:69938416-69938438 GGGTTGACAAACTATTAAGTTGG - Intronic
977274006 4:94952871-94952893 AGGTTCCCACACTATAATAGTGG - Intronic
978877053 4:113653705-113653727 GGGTTCAAAAACTGGAATATTGG + Intronic
980233783 4:130077879-130077901 AGGTTTACAAATTATAAAATAGG - Intergenic
990162388 5:52956560-52956582 GGGTTCACATAGTATAATGGAGG + Exonic
990495716 5:56345897-56345919 TTGTTCAAAAACTTTAATATGGG + Intergenic
995730470 5:115234977-115234999 GGGTTTAGAAACTAGAATCTGGG - Intronic
995880389 5:116838189-116838211 GAGTTCACCAACAATACTATGGG - Intergenic
998558175 5:143146412-143146434 TGGTTAACAATCTATAAAATGGG - Intronic
1007017898 6:38487961-38487983 GGGTGCACAAAGTATGAAATAGG + Intronic
1007245823 6:40461618-40461640 GTCTCCCCAAACTATAATATAGG - Intronic
1008930103 6:56930454-56930476 GGGCCCAAAAACTAAAATATAGG + Intronic
1009329958 6:62406004-62406026 GGTCTCAAAAAATATAATATGGG + Intergenic
1009360767 6:62809811-62809833 GGGTTGAATAATTATAATATTGG + Intergenic
1009871331 6:69455655-69455677 TAGTACACAATCTATAATATTGG - Intergenic
1012468518 6:99542798-99542820 GGATTCAAAAACCATAATGTTGG - Exonic
1012889764 6:104885149-104885171 GGGTTCATATAGTAGAATATTGG - Intergenic
1014469106 6:121793170-121793192 AGGTTCATAAAATAAAATATTGG + Intergenic
1017954320 6:159166304-159166326 GGGTTCTGAAACTCTAAAATTGG + Intergenic
1025850760 7:65241327-65241349 GCGTTCAGAAATTATAATTTGGG + Intergenic
1030240451 7:107317301-107317323 GAGTTCACAAAATAGAATACCGG + Intronic
1033830888 7:145250975-145250997 GGTTTTACAAACTATTATATAGG - Intergenic
1034211116 7:149364155-149364177 GGCTGCAAGAACTATAATATGGG - Intergenic
1035874013 8:3167312-3167334 TGGTTCACAAACTATTAGGTTGG + Intronic
1035990927 8:4489439-4489461 ATGTTCAAAAACTATAAAATGGG + Intronic
1038457552 8:27687333-27687355 GTATTCAGAAACTCTAATATTGG - Intergenic
1038512087 8:28147736-28147758 GGCTTTAGAAACTATAATCTTGG - Intronic
1039360481 8:36871607-36871629 AGCTTCACAGACTATAATAAAGG + Intronic
1042998266 8:74725403-74725425 GGGTTCACCACGTATAAAATGGG + Intronic
1043677940 8:82983417-82983439 GGTGTAACAAACTACAATATTGG + Intergenic
1044127853 8:88480378-88480400 GGCTACACTAACTTTAATATTGG - Intergenic
1044498956 8:92928598-92928620 TGGTTCTCAAACTTTAATGTTGG - Intronic
1047971564 8:130088882-130088904 AGCTTCTCCAACTATAATATGGG - Intronic
1050849104 9:10262254-10262276 GGGACTACAAACTATAAAATAGG + Intronic
1051013982 9:12452850-12452872 TGGTTAAAAAACTATAAAATTGG + Intergenic
1062575262 9:137203808-137203830 GGGGTCACAAACTATTCAATGGG + Intronic
1189216075 X:39325185-39325207 GGGTTTTCAAACTAAAAAATAGG - Intergenic
1192384989 X:70658933-70658955 GGGTTCCCAAACTATTCAATGGG + Intronic
1194575272 X:95605607-95605629 TGGTCCACATCCTATAATATCGG - Intergenic
1197979610 X:132201535-132201557 GGTTTCATCAACTATAAAATGGG + Intergenic
1198343063 X:135733531-135733553 AGGTGTACAAAATATAATATTGG - Intergenic
1198344926 X:135749764-135749786 AGGTGTACAAAATATAATATTGG + Intergenic
1198577137 X:138022902-138022924 GGTTTCATAATCTATAAAATGGG + Intergenic
1200731080 Y:6740717-6740739 GAGTTCCCAAACTATAAAAGGGG - Intergenic