ID: 1125159585

View in Genome Browser
Species Human (GRCh38)
Location 15:36627745-36627767
Sequence GCCCTGGCCCTGGTGATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 330}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125159585_1125159601 24 Left 1125159585 15:36627745-36627767 CCAACCATCACCAGGGCCAGGGC 0: 1
1: 0
2: 3
3: 44
4: 330
Right 1125159601 15:36627792-36627814 CAACCTGGGGACTCACTTCAGGG 0: 1
1: 0
2: 1
3: 12
4: 106
1125159585_1125159595 10 Left 1125159585 15:36627745-36627767 CCAACCATCACCAGGGCCAGGGC 0: 1
1: 0
2: 3
3: 44
4: 330
Right 1125159595 15:36627778-36627800 CGACCTGGCAGGCCCAACCTGGG 0: 1
1: 0
2: 1
3: 19
4: 142
1125159585_1125159594 9 Left 1125159585 15:36627745-36627767 CCAACCATCACCAGGGCCAGGGC 0: 1
1: 0
2: 3
3: 44
4: 330
Right 1125159594 15:36627777-36627799 CCGACCTGGCAGGCCCAACCTGG 0: 1
1: 0
2: 0
3: 10
4: 99
1125159585_1125159590 -1 Left 1125159585 15:36627745-36627767 CCAACCATCACCAGGGCCAGGGC 0: 1
1: 0
2: 3
3: 44
4: 330
Right 1125159590 15:36627767-36627789 CACAGCCAGCCCGACCTGGCAGG 0: 1
1: 0
2: 0
3: 22
4: 223
1125159585_1125159589 -5 Left 1125159585 15:36627745-36627767 CCAACCATCACCAGGGCCAGGGC 0: 1
1: 0
2: 3
3: 44
4: 330
Right 1125159589 15:36627763-36627785 AGGGCACAGCCAGCCCGACCTGG 0: 1
1: 0
2: 1
3: 23
4: 233
1125159585_1125159600 23 Left 1125159585 15:36627745-36627767 CCAACCATCACCAGGGCCAGGGC 0: 1
1: 0
2: 3
3: 44
4: 330
Right 1125159600 15:36627791-36627813 CCAACCTGGGGACTCACTTCAGG 0: 1
1: 0
2: 0
3: 19
4: 103
1125159585_1125159596 11 Left 1125159585 15:36627745-36627767 CCAACCATCACCAGGGCCAGGGC 0: 1
1: 0
2: 3
3: 44
4: 330
Right 1125159596 15:36627779-36627801 GACCTGGCAGGCCCAACCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125159585 Original CRISPR GCCCTGGCCCTGGTGATGGT TGG (reversed) Intronic
900102127 1:966420-966442 GCCCAGGCCCTGGTGCCGGGCGG + Intergenic
900431674 1:2605781-2605803 ACCCTGCCCCGAGTGATGGTGGG + Intronic
900617229 1:3570909-3570931 GCCCTGTCCCTGGGGATTGGTGG - Intronic
901000668 1:6147357-6147379 GCCCTGCCCCGGGTGAGGGATGG - Intronic
901101934 1:6725769-6725791 GCCCTGGTTCTGGAGATGGGTGG + Intergenic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901687254 1:10949740-10949762 TCTCTGGTCCTGGGGATGGTGGG + Exonic
902341126 1:15784379-15784401 GACCTGGCCCGGGTGTTGGGAGG + Intronic
903460438 1:23516909-23516931 GTCCTGGGCCTAGTGCTGGTTGG - Intronic
903765281 1:25730105-25730127 ACCTTGGCCTTGGTGCTGGTGGG - Intronic
906290826 1:44618220-44618242 GCCCTGGCTCTGGAGCTGGAAGG - Intronic
906325248 1:44841737-44841759 GGCCTGGCCCTGGGGCTGGAGGG - Intronic
907499144 1:54865806-54865828 TCCCTGGCCTTGGGGAAGGTGGG - Intronic
913087105 1:115449213-115449235 GCACTGGCCTTGGTCAGGGTGGG + Intergenic
913703972 1:121399605-121399627 GCCCGGGCCTTGGTGGGGGTGGG - Intergenic
913942619 1:125122101-125122123 GCCCGGGCCTTGGTGGGGGTGGG - Intergenic
913980322 1:143501313-143501335 GCCCGGGCCTTGGTGAGGGTGGG - Intergenic
914074670 1:144326801-144326823 GCCCGGGCCTTGGTGAGGGTGGG - Intergenic
914104506 1:144639645-144639667 GCCCGGGCCTTGGTGAGGGTGGG + Intergenic
914900705 1:151709688-151709710 GCCCTGGGCCTGGGGGTGGGAGG + Intronic
915111466 1:153566747-153566769 GCCCTGGCCCTGGGGGAGGAGGG - Intronic
915722599 1:157995364-157995386 GGCCTGGCCCTGGGGTTGGCAGG + Intronic
917178051 1:172261513-172261535 GCACTGGTGCTGGTGTTGGTGGG + Intronic
917454059 1:175170701-175170723 GGCCTGGCCATGGAAATGGTGGG - Intronic
917906530 1:179591567-179591589 GCCCTAGCTCTGGAGGTGGTTGG + Intergenic
920086118 1:203418580-203418602 GCACTGGCCATGGTGGTGGCGGG - Intergenic
922177843 1:223211025-223211047 GCCTTGGCCCTGTTGATGTTAGG + Intergenic
1062876180 10:944597-944619 GCCCTGGCACTGGCGCTGGCAGG - Intergenic
1063219102 10:3949963-3949985 ACCCTGGCAGTGGTGTTGGTGGG + Intergenic
1063850772 10:10187468-10187490 ACACTGGGCCTGTTGATGGTTGG - Intergenic
1064317990 10:14276089-14276111 GTCCTGGCCCTGTTGATGCTTGG + Intronic
1066052386 10:31647669-31647691 GCCCTGGTCCTGGGAATGCTAGG + Intergenic
1066106483 10:32161567-32161589 TCCCTGGGCTTGGTGATGGTGGG + Intergenic
1066781085 10:38945112-38945134 GCCCGGGCCTTGGTGGAGGTGGG - Intergenic
1069604353 10:69730382-69730404 GCCCTGGCCCTGGTCCTGCTGGG - Intergenic
1069872966 10:71544402-71544424 GCCCTCCCCCTGGTGAGGCTGGG - Intronic
1070288613 10:75100584-75100606 GCCCTGGCCCTGCTGGACGTTGG - Intronic
1070290041 10:75108201-75108223 GCCGTGGCCCTGGGGAGGGCAGG + Intronic
1070830037 10:79412469-79412491 GCCCAGTCCCTGGAGATGGGTGG - Intronic
1071293454 10:84203170-84203192 GCCCTGACCCTTGTGATTTTAGG + Intronic
1073336486 10:102714205-102714227 GCCCTGGGCCTGGGGACGGGAGG + Intronic
1073399091 10:103242111-103242133 CTCCTGGCCCTCGTGAGGGTGGG - Intergenic
1075212521 10:120503088-120503110 GCCCTGGCCATGGTGAGGATGGG - Intronic
1075721942 10:124592596-124592618 GCCATGGGCATGGTGGTGGTTGG - Intronic
1075793424 10:125102262-125102284 GTCCTGGCCTTGGTGATGGCAGG - Intronic
1075968132 10:126630445-126630467 GTCCTGGGCTTGGCGATGGTGGG + Intronic
1076530558 10:131141697-131141719 CTCCTGGCCCTGGAGGTGGTTGG + Intronic
1077412886 11:2411598-2411620 GCCCTGGCCCTGGCCCTGGAGGG - Intronic
1078107882 11:8370089-8370111 GCCCTGGCCCTTGGGAGGGCAGG - Intergenic
1078249775 11:9607471-9607493 GGCCTGGCCCTGGTGAGGAGAGG + Intergenic
1078317691 11:10306170-10306192 CCCCTGGCCCGGGGGATCGTCGG + Intronic
1078800796 11:14643248-14643270 GCCATGGCCTTGGTGGTGGCTGG + Intronic
1079689634 11:23404509-23404531 GCCCTGGCCAAGATGATGGACGG + Intergenic
1081799894 11:45850968-45850990 CTTCTTGCCCTGGTGATGGTGGG + Intronic
1084006724 11:66327013-66327035 GCCCTGGCCCTGGGTGGGGTGGG + Intergenic
1085019107 11:73193944-73193966 GGCCTGGACCTGGTGAGGCTTGG + Intergenic
1089258412 11:117206340-117206362 CCCCAGACCCTGGTGCTGGTAGG - Exonic
1090446300 11:126767507-126767529 ACCCTGGCCCTGTTGCTTGTTGG + Intronic
1091585992 12:1817244-1817266 GCCCTGGGCCTTGTGCTGGCTGG - Intronic
1091633427 12:2179333-2179355 TCCCTGGACCTGCTGATGATAGG + Intronic
1096792078 12:54051725-54051747 GCCCTGGCCCTGCTGAGCCTGGG + Intronic
1097262768 12:57728765-57728787 GCCCTGGGGCTGGTGGCGGTGGG + Intronic
1100776402 12:97979507-97979529 ACTCTGGCCCTGATGATAGTGGG - Intergenic
1102827858 12:115965439-115965461 GAGCAGGCCCTGGTGTTGGTGGG - Intronic
1103329308 12:120142786-120142808 TTCCTGCCCCTGCTGATGGTAGG - Intronic
1104566187 12:129886625-129886647 TCCCTGGCCCTGGCGATGCATGG - Intronic
1104756653 12:131273712-131273734 GCCCTGGCCCCCGGGATGGAGGG + Intergenic
1104785308 12:131444818-131444840 GCCATGGCCCTGGGGATGGGGGG - Intergenic
1104916705 12:132269259-132269281 GCTCTGGGCTTGGTGATGGGAGG + Intronic
1104935722 12:132363417-132363439 TGCCTGGCCCTTGTGATGGAGGG + Intergenic
1105344757 13:19561734-19561756 GTCCTGGCCCGGGTCAGGGTTGG - Intergenic
1105535284 13:21259833-21259855 GTCCTGGCCCGGGTCAGGGTTGG + Intergenic
1107853783 13:44594993-44595015 GCCCTGACCCAGCTGTTGGTGGG - Intergenic
1109618723 13:64872170-64872192 GCACGGGCACTGGTGGTGGTGGG - Intergenic
1111231932 13:85354783-85354805 GCCCTGCCACTGCTGCTGGTGGG + Intergenic
1111876979 13:93909943-93909965 ACCCTGGCCCTGGGGTGGGTAGG - Intronic
1112365631 13:98752801-98752823 GCCCCGGCCCAGGTGCGGGTGGG + Intergenic
1113093789 13:106641565-106641587 CTCCTGGCTCTGGTGAGGGTTGG - Intergenic
1114429870 14:22651649-22651671 CCCCTGGTCATGGGGATGGTGGG - Intergenic
1119159536 14:72441569-72441591 GTCCTGGCCCTGCTGAGGGCTGG - Intronic
1119771406 14:77222361-77222383 GGCCTGGACCAGGGGATGGTAGG - Intronic
1120204134 14:81569394-81569416 GCCCTTACCCTTGAGATGGTAGG - Intergenic
1121538352 14:94706768-94706790 ACCCTGGCCCTGGTCAAAGTTGG - Intergenic
1122551207 14:102550954-102550976 GCCTGGGCACTGGTGATGGGGGG + Intergenic
1122612272 14:102993616-102993638 GCCCTGGTCATGGGGAGGGTAGG - Intronic
1122685783 14:103505445-103505467 GCCTTGGCGCTGATGGTGGTTGG + Intergenic
1122865112 14:104600231-104600253 GGCCTGGCCTTGGTGAGGGAGGG - Intronic
1122986137 14:105212537-105212559 GCCCTGGGCCTGGTGAGGGTTGG - Intronic
1123062796 14:105601856-105601878 GCCCTGGGCCTGGGGATTGTGGG - Intergenic
1202939506 14_KI270725v1_random:134067-134089 GCCCGGGCCTTGGTGGGGGTGGG + Intergenic
1123393635 15:19901848-19901870 GCCCGGGCCTTGGTGGGGGTGGG - Intergenic
1124413698 15:29457485-29457507 GCCCTGGCCCTGGTGCCTGCTGG + Intronic
1124414455 15:29463366-29463388 CCCCTGGACCTGGTGAAGATCGG - Intronic
1124707521 15:31977935-31977957 GCCCCAGCCCTGGAGGTGGTAGG - Intergenic
1124962834 15:34410896-34410918 GCCCTGGGTCTGCTCATGGTGGG + Intronic
1124979457 15:34557118-34557140 GCCCTGGGTCTGCTCATGGTGGG + Intronic
1125159585 15:36627745-36627767 GCCCTGGCCCTGGTGATGGTTGG - Intronic
1125728689 15:41881142-41881164 ACCCTGGCCCTGGGGATGCCTGG - Exonic
1125768406 15:42149958-42149980 TCCCTGGTTCTGGTGCTGGTGGG - Intronic
1126859607 15:52871146-52871168 GCCTTGCCCCTGGGGATAGTAGG + Intergenic
1128182025 15:65612492-65612514 GCCCTGGCCCCAGTGCTGGCAGG - Intronic
1129678462 15:77644818-77644840 GGCCTGGCCCTGGTGACGAGCGG + Intronic
1130088086 15:80795360-80795382 GCTAGGGACCTGGTGATGGTGGG + Intronic
1130808497 15:87352443-87352465 GCACTGGCCCTGTTGTTGCTGGG + Intergenic
1131118097 15:89806573-89806595 CCCTTGGCCATGGTGATGGTGGG + Exonic
1132028920 15:98424839-98424861 GCCCTGCCCCAGGTGCTGGTCGG + Intergenic
1132292794 15:100714886-100714908 GCCCTCGCCATGGGGATGCTGGG + Intergenic
1132334546 15:101037583-101037605 GCCCTGCCACTGGGGAGGGTGGG + Intronic
1132746656 16:1439020-1439042 TTCCTGGCCCTGGAGAAGGTGGG - Exonic
1132996916 16:2828191-2828213 GCCCTGTCCGTGGTGCTGGATGG - Intergenic
1133013846 16:2929878-2929900 GTCCTGTCCCTGGAGATGGCTGG + Exonic
1133051591 16:3120254-3120276 GCCCTGGCCATGCTGATGCTGGG + Exonic
1133189805 16:4125251-4125273 GACCTGGCCCTGGAGAAGCTGGG - Intergenic
1134139574 16:11706379-11706401 GCCCTGGGCCCTGTGATCGTCGG + Intronic
1135293205 16:21257780-21257802 GACCAGGCCCTGGTGACAGTTGG + Intronic
1136378768 16:29881058-29881080 GCCATTGCCCTGGCGTTGGTGGG + Intronic
1136695922 16:32081970-32081992 GCCCGGGCCTTGGTGGGGGTGGG + Intergenic
1136699639 16:32119217-32119239 GCCCGGGCCTTGGTGGGGGTGGG - Intergenic
1136768019 16:32808704-32808726 GCCCGGGCCTTGGTGGGGGTGGG + Intergenic
1136771274 16:32843683-32843705 GCCCGGGCCTTGGCGAGGGTGGG + Intergenic
1136796417 16:33025223-33025245 GCCCGGGCCTTGGTGGGGGTGGG + Intergenic
1136868284 16:33773541-33773563 GCCCGGGCCTTGGTGGGGGTGGG - Intergenic
1136902532 16:34053657-34053679 GCCCAGGCCTTGGTGGGGGTGGG - Intergenic
1136958030 16:34806404-34806426 GCCCGGGCCTTGGTGGGGGTGGG - Intergenic
1137691298 16:50429964-50429986 CCCCTGGGCCTGGTGATGGTGGG - Intergenic
1138130894 16:54479021-54479043 GTGATGGCCATGGTGATGGTAGG - Intergenic
1138583908 16:57958367-57958389 GTGGTGGCCCTGGTGGTGGTGGG - Intronic
1139949815 16:70663368-70663390 GCCCTGGCTCTGGTGCTTATGGG + Exonic
1142138775 16:88463348-88463370 GCCCAGACCCTCGTGATGGGAGG + Intronic
1142140305 16:88469822-88469844 GCCCTGGCCAAGGTGATGTCTGG - Intronic
1142429010 16:90016436-90016458 GCCCTGGCCCTGGAGACCTTGGG - Intronic
1203070409 16_KI270728v1_random:1070724-1070746 GCCCGGGCCTTGGTGGGGGTGGG + Intergenic
1203073699 16_KI270728v1_random:1105793-1105815 GCCCGGGCCTTGGTGGGGGTGGG + Intergenic
1203103890 16_KI270728v1_random:1342735-1342757 GCCCGGGCCTTGGTGGGGGTGGG + Intergenic
1203129624 16_KI270728v1_random:1619633-1619655 GCCCGGGCCTTGGTGGGGGTGGG - Intergenic
1142614224 17:1125513-1125535 GGCCTGGGCCTGGTGAGGGGCGG + Intronic
1142906894 17:3049432-3049454 GCCCTGGCTCGGGTTATGGCCGG + Intergenic
1143100782 17:4503604-4503626 GCCCTGGCCTTGTTTATGGGTGG + Intronic
1143452241 17:7043016-7043038 GCCCGCCCCGTGGTGATGGTTGG - Exonic
1143729025 17:8869832-8869854 TGCCTTGCCTTGGTGATGGTAGG - Intergenic
1144494080 17:15736136-15736158 GCCTTGGCCCTGGCCCTGGTAGG + Intronic
1144731295 17:17527970-17527992 GCCCTGGGCCAGGTGGTGGGGGG - Intronic
1144906180 17:18640543-18640565 GCCTTGGCCCTGGCCCTGGTAGG - Intronic
1145710327 17:26965413-26965435 GCCCGGGCCTTGGTGGCGGTGGG - Intergenic
1146322397 17:31857230-31857252 GCACTGCCCCAGCTGATGGTAGG - Intronic
1146548110 17:33756556-33756578 GCCCTGGCTCTTGTGAGTGTAGG - Intronic
1146950180 17:36900197-36900219 GCCCTGGCCCCGCTGGGGGTGGG - Intergenic
1147245393 17:39116925-39116947 GCCCTGGCCCTTGTAATAATCGG - Intronic
1147324974 17:39665754-39665776 GCACTGCCCCTGCTGGTGGTAGG - Exonic
1148704996 17:49622331-49622353 GCCCTGTCCATGGTGGTGGTGGG - Intronic
1150435376 17:65150177-65150199 GCCCTGGGCCAGGTGAAGGCAGG + Intronic
1151422624 17:74008420-74008442 GACATGGCCCTCGTGATGGGGGG - Intergenic
1151505154 17:74522596-74522618 GCCCTGGCCTTGGAGCTGGTGGG - Exonic
1151747549 17:76019401-76019423 GCCCTGGCCTGGGTGCTGGCAGG - Intronic
1152515187 17:80819168-80819190 TCCTTGGCCCTGGTGATGCTGGG - Intronic
1152550550 17:81027851-81027873 GCACTGGCCCAGGTGAGGCTGGG - Intergenic
1152648427 17:81481136-81481158 GGCCTGCCGCTGGTGGTGGTGGG - Intergenic
1153997037 18:10451950-10451972 GCCCAGGTCCTGGTGATAATGGG - Intergenic
1154508794 18:15071483-15071505 CCCCTGCCCCTGGTGATTCTTGG - Intergenic
1156602532 18:38626205-38626227 GCGTGGGCCCTGGTGAGGGTTGG + Intergenic
1157299425 18:46468886-46468908 GCCCTGGGCCTGGGGACAGTAGG + Intergenic
1159228788 18:65577179-65577201 TCCCTGGCCCTGTTGATCCTTGG - Intergenic
1160272862 18:77403617-77403639 GCCCTGGCCTTGCTGGAGGTGGG + Intergenic
1160587853 18:79922730-79922752 GCCCTGGCCCTGCTGCTGTAAGG - Intronic
1160680503 19:409848-409870 GCCCCAGCCCTGGTGATGCAGGG + Intergenic
1160890949 19:1378505-1378527 GCCATGTCCCTGGGGATGGCAGG - Intergenic
1161016414 19:1985849-1985871 GCCCTGGCCCAGGTGGTGAGCGG - Exonic
1162479542 19:10920584-10920606 TCCCTGGGGCTGGTGGTGGTGGG + Intronic
1162924548 19:13923646-13923668 TCCCTGGCCCTGGGGATGGGTGG - Intronic
1163153284 19:15427287-15427309 GCCCTGGCCAAGATGATGGGCGG - Exonic
1163241779 19:16067933-16067955 GCACTGGCCCTGCTGGGGGTGGG - Intronic
1163796825 19:19342689-19342711 GCCCTGGCCCGGGCCCTGGTGGG - Intronic
1164485885 19:28655274-28655296 GCTCTGGCCCTGGAGTGGGTGGG - Intergenic
1164649351 19:29880874-29880896 ACCCTGGCCCTGGTGCTGGAGGG + Intergenic
1165923704 19:39314396-39314418 GGCCGGGCCCTGGTGGTGGAAGG - Exonic
1166310206 19:41958521-41958543 ATCCTGGCCAGGGTGATGGTGGG + Intronic
1166867426 19:45848475-45848497 GCCCTGGGCTAGGTGATGCTGGG - Intronic
1167208944 19:48121267-48121289 ACCCTGGACCTGGTGGTGATCGG - Exonic
1167443567 19:49524448-49524470 GCCCTGGCTCTGGGAGTGGTGGG + Intronic
1167661732 19:50799423-50799445 GCCCTGGCTCTGGGGAGGGCTGG - Intronic
1202679828 1_KI270712v1_random:147-169 GCCCAGGCCTTGGTGAGGGTGGG + Intergenic
924965135 2:69579-69601 GCCCTGGCCCTGCTGAGGGCAGG - Intergenic
925315680 2:2921441-2921463 GCCCTTCCCCTGGTGTTGGGAGG + Intergenic
926198590 2:10777987-10778009 GCCCTGGCTGGGGTGGTGGTTGG + Intronic
926530499 2:14039043-14039065 GGCCTGGCTCTGGTGAAGCTGGG - Intergenic
928197215 2:29224584-29224606 GCCCTGGCCCATGTGTTGGGGGG - Intronic
929544602 2:42847493-42847515 GCTCAGGCCCTGGTGCGGGTTGG + Intergenic
931227825 2:60349273-60349295 ACCCTGGCCCTGGTGTTTTTTGG - Intergenic
931778745 2:65562167-65562189 GGCCCAGCCCTGGTGCTGGTGGG - Intergenic
932357068 2:71075771-71075793 CCACTGGCCTTGGTGGTGGTGGG + Intronic
932592543 2:73075915-73075937 GGCTTGGTCCTGGTGAGGGTGGG - Intronic
933777430 2:85779503-85779525 GCCCTGGCCCTGGGGGTGCTGGG + Intronic
933808622 2:86018138-86018160 GCCCTGTCCCTGGGGTTGGGTGG + Intergenic
933902815 2:86861728-86861750 GTCCTGGCCCTGGTCCTGGCAGG - Intronic
934047245 2:88182870-88182892 GATCTGGCCCAGGTGTTGGTTGG + Intronic
935173761 2:100630099-100630121 CCCATGGCCCTGGGGATGGGAGG + Intergenic
935777732 2:106487541-106487563 GTCCTGGCCCTGGTCCTGGCAGG + Intergenic
938155810 2:128939181-128939203 ACCCAGGCTCTGGTGAAGGTTGG + Intergenic
938517845 2:132035467-132035489 GCCCGGGCCTTGGTGGGGGTGGG + Intergenic
938796901 2:134725077-134725099 GCCCTGCCACTGGAGAGGGTGGG - Intergenic
946640698 2:221780620-221780642 TCCCTGGCCTTGGTGAGGGAAGG + Intergenic
947108391 2:226691960-226691982 GTCCAGCCCCTGGTGATGGGTGG + Intergenic
948664121 2:239523882-239523904 GCCATGGACATGGTGGTGGTGGG + Intergenic
948697781 2:239741983-239742005 ACCGTGGCCCTGCTGGTGGTGGG + Intergenic
948797199 2:240411291-240411313 TCCCTGGCACCTGTGATGGTGGG - Intergenic
948897357 2:240933656-240933678 GCCTTCTCCCTGGGGATGGTGGG - Intronic
1168852656 20:987268-987290 GCTCTGGGCCTGAGGATGGTTGG + Intronic
1171369514 20:24652491-24652513 GCCCTCGGCCTGCTCATGGTTGG + Intronic
1172487373 20:35306480-35306502 TCCCTGGCCCAGTTCATGGTTGG + Intronic
1173498157 20:43533871-43533893 GAGCTGGCTGTGGTGATGGTGGG + Intronic
1175240310 20:57542753-57542775 GCCCTGGCACTACTGATGTTTGG + Intergenic
1175358771 20:58390396-58390418 CTCGTGGCCCTGGTGAAGGTAGG - Intronic
1175509569 20:59514780-59514802 GCCCTGGCCCTGGCCTTGGATGG - Intergenic
1175698047 20:61117191-61117213 ACACTGGCCCTGGTGAGTGTGGG - Intergenic
1175738516 20:61404182-61404204 GCCCTGGGACAGGTGGTGGTGGG - Intronic
1175889101 20:62308250-62308272 GCACTGGCCATGGTGAAGGTGGG - Intronic
1175995086 20:62808410-62808432 GCCGTGGCCCTGGTAATCGCCGG - Intronic
1176029753 20:63006208-63006230 GCCCTGGCCCTGGTTGAGGAAGG + Exonic
1176148197 20:63574626-63574648 CCCGTGGCCCTGGTGCTGCTGGG + Intergenic
1176345817 21:5745876-5745898 GCCCTGGCACTGCTGTTGGTAGG - Intergenic
1176352631 21:5866460-5866482 GCCCTGGCACTGCTGTTGGTAGG - Intergenic
1176499010 21:7578579-7578601 GCCCTGGCACTGCTGTTGGTAGG + Intergenic
1176540138 21:8143946-8143968 GCCCTGGCACTGCTGTTGGTAGG - Intergenic
1176559089 21:8326991-8327013 GCCCTGGCACTGCTGTTGGTAGG - Intergenic
1176583686 21:8553022-8553044 GCCCGGGCCTTGGTGGGGGTGGG - Intergenic
1176789280 21:13300266-13300288 CCCCTGCCCCTGGTGATTCTTGG + Intergenic
1177988443 21:28008424-28008446 CCCCTGCCCCTGGTGATTCTTGG + Intergenic
1179923743 21:44521480-44521502 GCCCTGGCCCTGGGGCAGCTGGG - Intronic
1179979043 21:44887029-44887051 CCCCTGGCCATGGTGATGGATGG - Intronic
1180006107 21:45021432-45021454 GCCACGGCCCTGGGGCTGGTGGG + Intergenic
1180266496 22:10529955-10529977 GCCCGGGCCTTGGTGGGGGTGGG - Intergenic
1180796630 22:18608961-18608983 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1180936051 22:19625940-19625962 GCCCTGGCCCAGGTGGCGGGAGG - Intergenic
1180947583 22:19705201-19705223 GACTTGGCCCAGGTGATGGCTGG - Intergenic
1180968135 22:19801088-19801110 GCCCTGTCCTTGGTGAGGCTGGG + Intronic
1180996405 22:19967984-19968006 GCCCAGGCACTGGTGAAGATGGG + Intronic
1181225094 22:21386310-21386332 TCCCTGGCCCTGGAAATGGGGGG + Exonic
1181253538 22:21548503-21548525 TCCCTGGCCCTGGAAATGGGGGG - Exonic
1181314706 22:21963790-21963812 GCCCTGGCTGTGGGGATGGGGGG - Intronic
1181391725 22:22588060-22588082 GCCCAGGCCCAGGTGAGGGTGGG + Intergenic
1181403208 22:22664318-22664340 GCCCAGGCCCAGGTGAGAGTGGG + Intergenic
1181407886 22:22697796-22697818 GCCCAGGCCCACGTGAGGGTGGG + Intergenic
1181415880 22:22758585-22758607 GCCCAGGCCCAGGTGAGGGTGGG + Intronic
1181424218 22:22822665-22822687 GCCCAGGCCCAAGTGAGGGTGGG + Intronic
1181428007 22:22856435-22856457 GCCCAGGCCCAGGTGAGGGTGGG + Intronic
1181499031 22:23305411-23305433 TCCCTGCCCCTGCTGAGGGTGGG + Intronic
1181510584 22:23387050-23387072 ACCCTGGCCCTGGACAGGGTGGG + Intergenic
1181624553 22:24114383-24114405 GCCCTGGCCCTGGCCAGAGTGGG - Intronic
1183301269 22:37060300-37060322 GCCCTGGCAGTGGTGGGGGTGGG - Intronic
1183304736 22:37076539-37076561 GCCCATGCCCTGGAGATGGGAGG - Intronic
1183723194 22:39573969-39573991 GCCCTGGCCATGGGGATGCCGGG - Intronic
1184037613 22:41926178-41926200 GTCCTGGCGCTGGTCCTGGTGGG - Exonic
1184379337 22:44135222-44135244 GGCATGGCAGTGGTGATGGTAGG - Intronic
1185006126 22:48277968-48277990 CCCCTGGCCCAGGGGAGGGTGGG + Intergenic
1185338905 22:50282994-50283016 GCCCTGGCCCTGGGTATGGAGGG - Intronic
1185370421 22:50458419-50458441 CCACTGGCACTGGGGATGGTCGG + Intronic
1203245081 22_KI270733v1_random:60305-60327 GCCCTGGCACTGCTGTTGGTAGG - Intergenic
1203285728 22_KI270734v1_random:153536-153558 GCCCTGGGCCTGATGAGGGGTGG - Intergenic
953891903 3:46756912-46756934 GCCCTGGTCGTGGTGTTGGCGGG + Intronic
953909277 3:46883498-46883520 CCGCCGGCCCTGGTGGTGGTAGG - Exonic
954372190 3:50174758-50174780 ACCCTGGCCCTGGGGGTGGAAGG - Intronic
954388753 3:50258154-50258176 CCACTGGCCCTGGTGGAGGTGGG + Intronic
954440152 3:50517320-50517342 GCCCTGGCACTGGTAATGATGGG + Intergenic
955075392 3:55608573-55608595 GCCTTGGCCCTGGTGATTTGGGG - Intronic
960901165 3:122555806-122555828 GCCCTGGCCCTGGTAAAAGCTGG - Exonic
961191683 3:124967780-124967802 GCCCAGAGCCTGGTCATGGTAGG + Exonic
961564384 3:127753332-127753354 GCCCTTTCCCTGCTGATGCTGGG + Intronic
961714977 3:128851947-128851969 GCCCTGGCCCTGGTCCTCCTTGG + Intergenic
962458045 3:135583402-135583424 GGGCTGGCCTTGGTGGTGGTGGG - Intergenic
962896816 3:139723037-139723059 ACCTTGGCACTCGTGATGGTTGG + Intergenic
964699994 3:159555229-159555251 ACTCTGGCCCTGGTTGTGGTAGG + Intronic
965544765 3:169904051-169904073 GGCCTGGCCATGGGGATGGGCGG - Intergenic
966553224 3:181229467-181229489 GCCTTGGCCTTGATGAGGGTGGG + Intergenic
966793582 3:183694478-183694500 ACCCTGGCAGTGGAGATGGTGGG - Intergenic
968426527 4:527136-527158 GCCCTGGCGCTGGGGCTGCTGGG + Exonic
968654112 4:1771320-1771342 GGCCTGGCCATGGCGATGGGGGG + Intergenic
968927982 4:3559983-3560005 GGCCTGGCACTGGTGATGCAGGG + Intergenic
969526779 4:7707876-7707898 GCCCTGGTCCTGGGGGTGATGGG - Intronic
969891445 4:10263858-10263880 GCCCTGGCCTGGGTGACGCTGGG - Intergenic
970628048 4:17911857-17911879 GACCTGGCCGTGGGGATGGCCGG + Intronic
978810105 4:112840254-112840276 GCACTGGCCCAGGACATGGTAGG + Intronic
979494453 4:121368685-121368707 ACTCTGGCCCTGTTGATGGCTGG - Intronic
982260251 4:153488418-153488440 GACCGGGCCCTGGTGAGGGCAGG + Intronic
990671882 5:58140460-58140482 ACCTTGCCTCTGGTGATGGTAGG - Intergenic
997825814 5:137106124-137106146 GTCCTGGCTCTGGTTGTGGTGGG - Intronic
999448844 5:151663678-151663700 CCCCTGCCCCTGGGGATGGGTGG - Intronic
1000036131 5:157449566-157449588 GGCCTGGCCCTGGAACTGGTAGG + Intronic
1002075091 5:176703643-176703665 CCCCAGGCCCTGGGCATGGTGGG + Intergenic
1002712894 5:181205498-181205520 GCCCTTGCCCCGGCGATGCTGGG - Intergenic
1006185869 6:32181423-32181445 GCCCTGGCCCTGGGGATCCTGGG - Exonic
1006217802 6:32460151-32460173 CCCCTCGCCCTGCTGATTGTGGG - Intergenic
1006472792 6:34237703-34237725 GCCCGGGCCCGGGTGAGGGGCGG + Intronic
1007514494 6:42400549-42400571 GCATGGGCCCTGGTGGTGGTGGG - Intronic
1007693868 6:43719517-43719539 GCCTGGGCCCTGGGAATGGTGGG + Intergenic
1009952602 6:70413861-70413883 GCCCCGGCCCCGTTGAAGGTCGG + Intronic
1019061215 6:169259510-169259532 GCCCTGGCCCTGGGAATTCTGGG - Intergenic
1019177552 6:170167918-170167940 GGGCTGGCCCTGGAGATGCTGGG - Intergenic
1019402397 7:863247-863269 GCCCTGGCGCTGGTGAATGCTGG - Intronic
1019402415 7:863307-863329 GCCCTGGCGCTGGTGAACGCCGG - Intronic
1019527713 7:1488195-1488217 GCCTTGGCTCTGGTGAGGGCAGG - Intronic
1019532485 7:1510795-1510817 CCCCAGCCCCTGGTGCTGGTGGG - Intergenic
1020001644 7:4759457-4759479 ACCCTGACCATGGTGACGGTGGG - Exonic
1020685664 7:11290427-11290449 CCCCTGGCCCTCTTAATGGTGGG + Intergenic
1020999759 7:15314064-15314086 GCCATGGCAGTGTTGATGGTTGG + Intronic
1021975080 7:26004074-26004096 ACCCTGCACCTGGTGATGCTGGG + Intergenic
1023996346 7:45161302-45161324 GCCCTGGCACTGGGGGTGGTGGG + Intronic
1025106110 7:56173604-56173626 GACATTGCCCTGGTCATGGTAGG - Intergenic
1025198505 7:56948880-56948902 GCCCTGGCCATGGAGGGGGTCGG - Intergenic
1025207110 7:57000282-57000304 GCCCTGCCTCTGGAGGTGGTTGG + Intergenic
1025230477 7:57200783-57200805 ACCCTGGCCCTGCTGAGGGAGGG + Intergenic
1025562370 7:62383298-62383320 GCCCAGGCCTTGGTGGGGGTGGG - Intergenic
1025673446 7:63628053-63628075 GCCCTGGCCATGGAGGGGGTCGG + Intergenic
1025840767 7:65143713-65143735 GCCCAGGCCTTGGTGCGGGTGGG - Intergenic
1025877947 7:65506450-65506472 GCCCGGGCCTTGGTGCGGGTGGG + Intergenic
1025882283 7:65552243-65552265 GCCCGGGCCTTGGTGCGGGTGGG + Intergenic
1025891159 7:65650359-65650381 GCCCGGGCCTTGGTGCGGGTGGG - Intergenic
1026916073 7:74121064-74121086 GCCCTGGCCTGGGAGACGGTGGG + Intronic
1027201062 7:76064223-76064245 TCCCATGCCCTGGTGATGGGAGG + Intronic
1029116394 7:98239769-98239791 TCCCTGGCCCGGGGGATGGACGG - Intronic
1029283954 7:99453493-99453515 GCCCTGGCCCTCCTCCTGGTGGG + Intronic
1029436300 7:100565833-100565855 ACCCAGGCTCTGGGGATGGTGGG - Exonic
1029646562 7:101860554-101860576 GCCCTGGGACAGGTGATGGCAGG - Intronic
1032240512 7:130155277-130155299 GCCCAGGCCCTGCTGGTGCTGGG - Intergenic
1033259588 7:139831272-139831294 GCCCTGGCTCTGGTGCTTTTGGG + Intronic
1033283907 7:140024792-140024814 TTCCTGGCCCGGGTGCTGGTGGG - Exonic
1034200717 7:149281637-149281659 GCCCTGGGCCTGATGACGGCTGG - Exonic
1034383757 7:150720833-150720855 GGCCTGGCCCTGCTGCTGGGGGG + Exonic
1034498112 7:151433885-151433907 GCCCTTCCCCAGGTGAGGGTAGG + Intronic
1035051676 7:156002366-156002388 GGCCTGGTCCTGCTGATGGCAGG + Intergenic
1035364956 7:158343301-158343323 GCCTTGACGCTGGTGATGCTGGG - Intronic
1039434332 8:37549247-37549269 GCCCTGGCTCTGGTGATTGTTGG - Intergenic
1040572045 8:48619992-48620014 CTCCTGGCCTGGGTGATGGTGGG - Intergenic
1042040266 8:64581713-64581735 GGCCTGGCCCTGGTTGAGGTAGG - Exonic
1044006029 8:86937749-86937771 GCCCTGTGGCTTGTGATGGTGGG + Intronic
1046035097 8:108831336-108831358 TCTCTGTCCCAGGTGATGGTAGG + Intergenic
1046385801 8:113507730-113507752 CCCCTGGCTCTTGAGATGGTGGG - Intergenic
1047271808 8:123367531-123367553 GTCCTGTGCCTGGTGGTGGTGGG + Intronic
1048767607 8:137862004-137862026 GCCATAGCCCAGGTGATGTTAGG + Intergenic
1049398971 8:142416363-142416385 GGCCTCCCCCTGGTGACGGTGGG + Intergenic
1049401137 8:142427867-142427889 GCCCTGGTGCTGGTGTTGGCAGG - Intergenic
1049426833 8:142541508-142541530 GCCCTGGGCCTTGTGTGGGTGGG - Intronic
1049575276 8:143386949-143386971 GCTGTGACCCTGGTGATGGTGGG - Intergenic
1049686171 8:143940153-143940175 GCCCTGGCCCTGGGGCCAGTGGG + Intronic
1049818249 8:144618606-144618628 GCCCTGGGCCTGGGGATGGAGGG - Intergenic
1050418370 9:5437631-5437653 GCACTGCCCCTGGTGCTGATAGG - Intronic
1051591221 9:18777857-18777879 TTCCTGGCCCAGCTGATGGTAGG - Exonic
1053164528 9:35835181-35835203 GCCGTGGGCCTGGGGAAGGTGGG - Exonic
1053802840 9:41775064-41775086 GGCCTGGCACTGGTGATGCAGGG + Intergenic
1054142407 9:61540006-61540028 GGCCTGGCACTGGTGATGCAGGG - Intergenic
1054191145 9:61986410-61986432 GGCCTGGCACTGGTGATGCAGGG + Intergenic
1054462151 9:65471156-65471178 GGCCTGGCACTGGTGATGCAGGG - Intergenic
1054647224 9:67601307-67601329 GGCCTGGCACTGGTGATGCAGGG - Intergenic
1057290508 9:93803128-93803150 GCCCTGCCCCATGTGATGCTGGG + Intergenic
1057686975 9:97243533-97243555 GCACTGGACTTGGTGATGATTGG + Intergenic
1058098324 9:100888788-100888810 GTCTTGGCCCTGGTGCTGGGTGG - Intergenic
1059399649 9:114060920-114060942 GCGGTGTCCCTGGTGATGGTAGG - Exonic
1060510461 9:124228564-124228586 GCCCTGGCCTTGGGCATGGCAGG + Intergenic
1060966772 9:127716076-127716098 GCCCTGGCCCTGACGTTGCTAGG - Exonic
1061008669 9:127942705-127942727 TCCCTTGCCCTGGTGGTGGGGGG - Exonic
1061315471 9:129792911-129792933 GCCCTGGTGCTGGTGGTGGTGGG - Intergenic
1062042335 9:134409829-134409851 GCCCTGGGCCTTGTGGAGGTGGG + Intronic
1062354918 9:136157410-136157432 GCCCTGGGCCTGCTCGTGGTGGG + Intergenic
1062451239 9:136616644-136616666 GCCCTGGCCCTGGAGGGGGATGG - Intergenic
1062702226 9:137913323-137913345 GCCATGTCCGTGGTGAGGGTAGG - Intronic
1203461416 Un_GL000220v1:43384-43406 GCCCTGGCACTGCTGTTGGTAGG - Intergenic
1203613642 Un_KI270749v1:30790-30812 GCCCGGGCCTTGGTGGGGGTGGG - Intergenic
1185472434 X:392213-392235 GCCGTGGCCGGGGTGATGGATGG + Intergenic
1185478935 X:432144-432166 GCTCTGGCACTGCTGATGTTTGG + Intergenic
1187464367 X:19514841-19514863 GCCCTGGCTCGTGTGAGGGTAGG + Intronic
1190247564 X:48700536-48700558 CACCTGGCCCTGGTCATTGTAGG - Exonic
1193370683 X:80694014-80694036 GCCCTGGGTCTTGTGATGGGAGG - Intronic
1194034439 X:88853728-88853750 GCCCCTGCCCTAGTGATGTTTGG + Intergenic
1194176889 X:90661830-90661852 GCCCTGGTGCTGGAGATGGTTGG + Intergenic
1198725016 X:139667746-139667768 GCCCTGTCACTGGAGAGGGTGGG + Intronic
1200163066 X:154019131-154019153 GCCGTGGCCGTGGTCAAGGTGGG + Intronic
1200301318 X:154979544-154979566 GCCCTGCTCTTGGTGAAGGTGGG + Intronic
1200523511 Y:4242681-4242703 GCCCTGGTGCTGGAGATGGTTGG + Intergenic
1202604334 Y:26626322-26626344 GTCGTGGTCCAGGTGATGGTGGG - Intergenic