ID: 1125161302

View in Genome Browser
Species Human (GRCh38)
Location 15:36647645-36647667
Sequence CTGTCTGTGCTAAGGTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125161297_1125161302 18 Left 1125161297 15:36647604-36647626 CCTCAGTAGCCTTTTGTTGGAAA 0: 1
1: 0
2: 1
3: 18
4: 176
Right 1125161302 15:36647645-36647667 CTGTCTGTGCTAAGGTAAATTGG 0: 1
1: 0
2: 2
3: 10
4: 168
1125161299_1125161302 9 Left 1125161299 15:36647613-36647635 CCTTTTGTTGGAAATGTGCAGGT 0: 1
1: 0
2: 0
3: 18
4: 180
Right 1125161302 15:36647645-36647667 CTGTCTGTGCTAAGGTAAATTGG 0: 1
1: 0
2: 2
3: 10
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125161302 Original CRISPR CTGTCTGTGCTAAGGTAAAT TGG Intronic
902632651 1:17714601-17714623 CTGTCTGTGCTAGAATAAAAAGG - Intergenic
903012510 1:20341405-20341427 CTGTCAGTGCTAATGTAAATGGG - Intronic
903785051 1:25855230-25855252 CTGTCTGTGCTCAAGGAAAGGGG + Intronic
904824431 1:33265367-33265389 CTGTCTGTGCCCAGGTCAGTGGG - Intronic
904859804 1:33527332-33527354 CTGTCTGACCTTAGGTCAATGGG + Intronic
909089524 1:71208000-71208022 TTTTCTGTGCTAAGTTAACTGGG - Intergenic
910142605 1:84042721-84042743 CTGTTTGAGCTTAGCTAAATTGG + Intergenic
912420762 1:109540768-109540790 CTGTCTGTTAAGAGGTAAATTGG + Intronic
913292484 1:117286600-117286622 CTTTCTGAGGTAAGGGAAATAGG + Intergenic
915711238 1:157900938-157900960 CTGTTTGTGAAAATGTAAATTGG - Intergenic
917599539 1:176560468-176560490 CTGTCTCCGCTATGGGAAATAGG - Intronic
919867040 1:201790077-201790099 CTTTCTGTGCCATGGTAGATGGG + Intronic
1067154722 10:43769200-43769222 CTGTTGGTGCAAATGTAAATTGG - Intergenic
1067297727 10:44984364-44984386 CTGTGTGTGCTATGGGAAACAGG + Intronic
1070099827 10:73374431-73374453 CTGTTGGTGGGAAGGTAAATTGG + Intergenic
1075674756 10:124288675-124288697 TTGTCTGTGCTGCGGGAAATAGG + Intergenic
1078394492 11:10967920-10967942 CTGTTGGTGGGAAGGTAAATTGG + Intergenic
1080707096 11:34706808-34706830 CTCTCTGTGCTAAGCCAACTGGG + Intergenic
1081334167 11:41843265-41843287 ATGTCTTTGCTGTGGTAAATAGG - Intergenic
1082980283 11:59114561-59114583 CTGTCAGTGCTAAGGTGCTTGGG - Intronic
1085646244 11:78224890-78224912 ATGTATGTGCTAAGGTAGACTGG - Intronic
1085711574 11:78833728-78833750 CTGTCTGAGAAAAGGTGAATCGG + Intronic
1085864743 11:80277718-80277740 CTGTTTGTGGTAATGTTAATTGG + Intergenic
1086293652 11:85340032-85340054 CTGTTGGTGCTAGTGTAAATTGG + Intronic
1090708769 11:129365991-129366013 CTGTTTGTGGGAATGTAAATTGG - Intergenic
1091533255 12:1380528-1380550 CTGTCTTAGCTAAGGCAAAGGGG + Intronic
1092938770 12:13387886-13387908 CTGCCTGTGCTATGGTTAATTGG - Intergenic
1093128264 12:15356863-15356885 CTTTCTGTGCTATGGTAGACAGG + Intronic
1093377508 12:18449086-18449108 CTGTTGGTGCAAATGTAAATTGG - Intronic
1093378889 12:18466745-18466767 CTGTTTGTGCTAAAGTAAAGTGG - Intronic
1095134245 12:38579227-38579249 CTGTTGGTGGTAATGTAAATTGG + Intergenic
1095296825 12:40536240-40536262 CTGTGGGTGGAAAGGTAAATTGG - Intronic
1097699472 12:62805252-62805274 CTGTCAGTGGGAATGTAAATTGG + Intronic
1098058417 12:66534056-66534078 CTGTCTGAGCTAAGTGAAAGGGG + Intronic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1103933786 12:124464671-124464693 CTGTCTGTCCTAAGGGCACTAGG + Intronic
1104289457 12:127455180-127455202 CTTTCTGTGCTAAGCCACATGGG + Intergenic
1105203361 13:18197779-18197801 CTGTTTGTGGAAATGTAAATTGG - Intergenic
1105269536 13:18858795-18858817 GTGTTGCTGCTAAGGTAAATTGG - Intergenic
1108376107 13:49815617-49815639 TAGTCTCTGCTAAGGTCAATGGG - Intergenic
1108943444 13:55988337-55988359 CTGTTGGTGATAAGGTAAATTGG + Intergenic
1109510802 13:63369798-63369820 CTGTAAGTGCCAATGTAAATAGG - Intergenic
1109584719 13:64384338-64384360 ATGTCTGTAATAAGGTAAATAGG - Intergenic
1109660265 13:65448873-65448895 CTGTTTGTGGAAATGTAAATTGG + Intergenic
1109662525 13:65482719-65482741 CTGTTGGTGGTAATGTAAATTGG - Intergenic
1110525822 13:76535693-76535715 CTGTTTGTGTGAATGTAAATTGG + Intergenic
1111495808 13:89048392-89048414 CTGTTGGTGGTAATGTAAATTGG + Intergenic
1113128191 13:107003836-107003858 CTGTCAATGCTGAGCTAAATAGG - Intergenic
1116776252 14:49184539-49184561 CTGTTTGTGGGAAAGTAAATTGG + Intergenic
1117436760 14:55722541-55722563 CTTTTTGAGCTAATGTAAATTGG + Intergenic
1118244952 14:64101223-64101245 CTGTCGGTGGGAATGTAAATTGG - Intronic
1121987914 14:98526482-98526504 CTGGCTGTGCTAAGTGATATGGG + Intergenic
1122587979 14:102824167-102824189 CTGTCTGTACAAACATAAATGGG - Intronic
1124138176 15:27053527-27053549 CTGTTGGTGAGAAGGTAAATTGG + Intronic
1125125682 15:36217784-36217806 ATGCCTGTGCTATGGTATATAGG + Intergenic
1125161302 15:36647645-36647667 CTGTCTGTGCTAAGGTAAATTGG + Intronic
1129376854 15:75138971-75138993 CTGTTTGTGCAAAGGGACATGGG - Intergenic
1129646364 15:77437482-77437504 TTCTCAGTGCTAAGCTAAATTGG + Intronic
1129658063 15:77537697-77537719 CTCTCTGTGCAATGGGAAATTGG + Intergenic
1131355250 15:91739955-91739977 CAGTATGTGTTAAGGTATATTGG - Intergenic
1134064755 16:11220906-11220928 CTGCCTGTGCCTTGGTAAATGGG + Intergenic
1140143990 16:72287577-72287599 GTGTCTGTCCTAAGATCAATGGG + Intergenic
1140811107 16:78578852-78578874 CTGTCTGTGAACAGGTTAATGGG + Intronic
1141035795 16:80624266-80624288 CTGACTGTGGTATGGCAAATAGG - Intronic
1141934725 16:87229629-87229651 CTGTCGGTGCTAATGGAATTGGG + Intronic
1146085935 17:29829726-29829748 CTGTCTTTGCTATGGAGAATGGG - Intronic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1150826723 17:68482738-68482760 CTGTTTTTACTAAGGTCAATCGG + Intergenic
1152420992 17:80193208-80193230 CTGTCTGTGCCAGGTTGAATCGG - Intronic
1156887819 18:42156093-42156115 CTGCATGTGCTAAGGAAAGTTGG + Intergenic
1157818044 18:50744925-50744947 CTGTCTGTTTTTAGGAAAATGGG + Intergenic
1160146603 18:76370725-76370747 CTGTAAGTGTTACGGTAAATTGG - Intronic
1162221870 19:9184039-9184061 CTGTCGGTGGTAATGTAGATTGG + Intergenic
1166156937 19:40920756-40920778 CTATCTTTGCTATTGTAAATAGG + Intergenic
928486202 2:31735008-31735030 TTTTCTTTGCTAAGGAAAATGGG + Intergenic
928872247 2:35993489-35993511 ATGTCTGTGCTGAGATCAATAGG - Intergenic
929436909 2:41935789-41935811 ATGTCTTTGCTATTGTAAATAGG + Exonic
930037794 2:47098560-47098582 CTGTTTGTGCTAAGATAAATGGG - Intronic
931544420 2:63365755-63365777 CTGCGAGTGGTAAGGTAAATGGG - Intronic
932015452 2:68022311-68022333 CTGTTTGTGGGAATGTAAATTGG - Intergenic
933059116 2:77713601-77713623 ATGTCTGTGTTAAGATAAAGGGG - Intergenic
934173495 2:89559216-89559238 CTGTCCTTGCTATGGTAAAACGG + Intergenic
934283809 2:91633569-91633591 CTGTCCTTGCTATGGTAAAACGG + Intergenic
934952638 2:98588521-98588543 CTGTCTTTTCAAAGATAAATTGG - Exonic
936880067 2:117239821-117239843 CTGTTTGTGGGAATGTAAATAGG + Intergenic
937234104 2:120419976-120419998 GTGTGTGTGGAAAGGTAAATGGG - Intergenic
938969674 2:136420683-136420705 CTTTCTGTGATGAGGTGAATTGG + Intergenic
940383544 2:153044115-153044137 ATGTCTTTGCTATTGTAAATAGG + Intergenic
941238758 2:163011185-163011207 CTGGCTGTGCTATGTTGAATAGG + Intergenic
942348984 2:175032899-175032921 ATGTCTTTGCTATGGTGAATAGG + Intergenic
946109440 2:217401375-217401397 CTGTCTGTGTCATTGTAAATAGG + Intronic
948224921 2:236301362-236301384 CTGTCTTTGCTTAGGTAACCAGG - Intergenic
1168849661 20:967862-967884 CTGTCTGTGCTGGGGTGAAAGGG + Intronic
1169489001 20:6055767-6055789 CTGTCCGTGCAAAGGCAAAGAGG - Intergenic
1169910006 20:10640296-10640318 CTGTCTGTGCTAATTTGAATCGG - Intronic
1170096123 20:12647818-12647840 CTGTCTGTGCTAAACTCAAATGG + Intergenic
1175164518 20:57033811-57033833 CTGCCTTTGCTAAGGGAAAGAGG + Intergenic
1176202637 20:63869456-63869478 CTGTCTGTCCTGGGGTGAATTGG + Intronic
1176714602 21:10340239-10340261 CTGTTTGTGGAAATGTAAATTGG + Intergenic
1178471878 21:32901084-32901106 CTGTTGGTGGAAAGGTAAATTGG + Intergenic
1179310285 21:40189500-40189522 CTGGGTGTGCTAAGGGACATAGG - Intronic
1182983210 22:34692207-34692229 CTGTCAGTGGGAAAGTAAATTGG - Intergenic
1184417595 22:44361262-44361284 CTGCGGGTGCCAAGGTAAATAGG + Intergenic
1185308983 22:50142525-50142547 CTGTCTGTGCTTTGTTAAAGAGG - Intronic
953270815 3:41442246-41442268 TTGTTTGTGCTAAGGAAAAACGG + Intronic
953817581 3:46172892-46172914 CTGTTTGTGGGAATGTAAATTGG - Intronic
954668346 3:52273121-52273143 CTGTCTTTGCTATTGTAGATGGG - Intronic
955471382 3:59290074-59290096 CTGTCTATGCCAAGGTAGCTGGG + Intergenic
961981345 3:131082466-131082488 CTTTCTGTGCTGATGGAAATGGG + Intronic
967359383 3:188612238-188612260 CTGTCTGTGCTTTGGGAAAGGGG + Intronic
970319957 4:14865376-14865398 CTGTGTGTGCAAAGGTATACAGG + Intergenic
973143881 4:46801300-46801322 CTGTCTTTGCTATTGTAAGTAGG - Intronic
974402611 4:61425654-61425676 CTATCTGTGCTAAAGTTACTGGG + Intronic
974507880 4:62800478-62800500 CTGTCAGTGGGAATGTAAATCGG - Intergenic
976073959 4:81275397-81275419 CTGTCGGTGGCAATGTAAATTGG + Intergenic
977096874 4:92757339-92757361 CTATCTGTGATGAGGTAAAAAGG + Intronic
978076379 4:104535578-104535600 CTGTTTGTGGAAATGTAAATTGG - Intergenic
979564017 4:122134102-122134124 CAGTCAGGGCTGAGGTAAATTGG + Intergenic
980194451 4:129570533-129570555 CAATCTGTGGGAAGGTAAATGGG + Intergenic
981024937 4:140068291-140068313 CTGTGTGTGCTCAGGTTGATGGG - Intronic
981043423 4:140244048-140244070 GTGTCTGTGTTAAGGCAAAATGG - Intergenic
983609860 4:169631057-169631079 CTGTCAGTGGGAATGTAAATTGG - Intronic
983640037 4:169936665-169936687 CTGTGTGAGCTAAGCTAAATAGG + Intergenic
984035057 4:174656784-174656806 CTGTCTGTGGGAAGGTAAAGTGG + Exonic
984963066 4:185116384-185116406 CTGTTAGTAATAAGGTAAATTGG + Intergenic
985331077 4:188834881-188834903 TTGTTTGTACTATGGTAAATGGG - Intergenic
985879244 5:2626103-2626125 CTATCATTGCTAAGGTAAAATGG + Intergenic
986090070 5:4495588-4495610 CTGTCTGTGGGAGGGTAAAATGG - Intergenic
986511916 5:8516934-8516956 CTGACAGTGCTAAGGAGAATGGG - Intergenic
987561938 5:19535343-19535365 CTTTGTGTGCTAAGGGAAATTGG + Intronic
989510800 5:42285471-42285493 CTGTCTGTGCTAAGAAACAGAGG - Intergenic
991484506 5:67120385-67120407 CTCTCCATGCTAAGATAAATGGG + Intronic
993899009 5:93571957-93571979 CTGACTGAGCAAAGGGAAATCGG + Intergenic
996538437 5:124603301-124603323 CTTTCTCTGATAAGGCAAATTGG - Intergenic
998976915 5:147658809-147658831 CTGACTGTGCTAAGGCGACTGGG - Intronic
1000708861 5:164545717-164545739 CTGTCGGTGGGAATGTAAATTGG - Intergenic
1007833275 6:44655147-44655169 CTGTCTTTGCTAAGGAAAGAAGG + Intergenic
1010469474 6:76209614-76209636 CTGTTTGTGGGAATGTAAATGGG + Intergenic
1011884406 6:92076210-92076232 TGGTCTGTGCTCAGGAAAATAGG - Intergenic
1012898308 6:104977258-104977280 CTGTTTGTGCAAAGGAAAAGTGG - Intronic
1014313923 6:119839889-119839911 CTATTAGTGGTAAGGTAAATTGG - Intergenic
1015420377 6:133001167-133001189 GTGTCTGTGCTGAGGTGACTTGG + Intergenic
1016734565 6:147462678-147462700 CTTTCTGTACTACGGTCAATAGG + Intergenic
1016983151 6:149871637-149871659 CTGTCAGTGGGAATGTAAATTGG - Intergenic
1018043689 6:159947336-159947358 CTCTCTGTGCTTAGGAAAAGTGG + Intergenic
1022801181 7:33779095-33779117 CGGTCTGTGTTAAGGTAACTAGG - Intergenic
1023696123 7:42849227-42849249 GTGTCAGTGGTAAAGTAAATTGG + Intergenic
1024984048 7:55180714-55180736 CTGACTGTGCTCTGGGAAATGGG - Intronic
1027754823 7:82199573-82199595 TTCTCTCTGCTAATGTAAATAGG - Intronic
1029904765 7:104080283-104080305 CAGTCAGTGCATAGGTAAATGGG + Intergenic
1033589158 7:142796304-142796326 CTGTCTGTGCTAAGGGAGGTGGG + Intergenic
1035467637 7:159090250-159090272 ATGTCTGTGCTGAGGTCACTGGG - Intronic
1035467730 7:159090720-159090742 ATGTCTGTGCTGAGGTCACTGGG - Intronic
1037598735 8:20375578-20375600 CTGTATGACCTCAGGTAAATGGG - Intergenic
1040689304 8:49914965-49914987 CTCACTCTGCTAAGCTAAATAGG - Intronic
1041242860 8:55863259-55863281 TTGTTTGAGCTAAGGTAATTGGG + Intergenic
1043316715 8:78931947-78931969 TTGTTTTTGCTAAGGGAAATTGG + Intergenic
1043427556 8:80163018-80163040 CTGTTGGTGCAAATGTAAATTGG + Intronic
1043751334 8:83939626-83939648 CTGTTTGTGGGAATGTAAATTGG - Intergenic
1044081239 8:87887207-87887229 CTATCTGTGCCAAGTTAACTAGG - Intergenic
1045051411 8:98330239-98330261 GTGTCTGTGAAAAGGTAACTTGG + Intergenic
1045426679 8:102074022-102074044 CTGTCTGTCCCATGGTATATAGG + Intronic
1045697287 8:104823910-104823932 ATGTCTTTGCTATTGTAAATAGG - Intronic
1046505943 8:115138310-115138332 CTTTCTATGCTATGTTAAATAGG + Intergenic
1050174741 9:2857944-2857966 CTGTCTGTTCTGAGGCAATTCGG + Intergenic
1050645876 9:7719000-7719022 CTTTAAGTGCTAGGGTAAATGGG - Intergenic
1051827567 9:21237019-21237041 GTGTCTTTGCTATTGTAAATAGG + Intronic
1056096219 9:83256914-83256936 CTGTTGGTGGGAAGGTAAATTGG + Intronic
1187659832 X:21531367-21531389 ATTTATGTGCTAAGGTAAACTGG + Intronic
1188703562 X:33297377-33297399 CTGTTTGTGGGAATGTAAATTGG + Intronic
1190409166 X:50117520-50117542 ATGTCTTTGCTATTGTAAATAGG + Intergenic
1193232973 X:79070382-79070404 CTGTCTGTTCTAACTTGAATGGG + Intergenic
1193420325 X:81275074-81275096 CTCACTGTGCTAAGTTAAAATGG - Intronic
1193605430 X:83562184-83562206 ATGTCTCTGCTATTGTAAATAGG + Intergenic
1193657415 X:84215278-84215300 CTGTTTGTGGGAATGTAAATTGG + Intergenic
1193913532 X:87336073-87336095 CTGTCAGTGGGAATGTAAATTGG + Intergenic
1195198758 X:102525662-102525684 ATGTCTTTGCTATTGTAAATAGG - Intergenic
1197899639 X:131356360-131356382 CTGACTGTGCTATGCCAAATTGG - Intronic
1198628481 X:138606719-138606741 ATGTCTTTGCTAATGTGAATAGG + Intergenic
1199395137 X:147328092-147328114 CTGTTGGTGGGAAGGTAAATTGG - Intergenic
1201711863 Y:17001108-17001130 CTGTCTTTTCTAAGGAAAAAGGG + Intergenic