ID: 1125166670

View in Genome Browser
Species Human (GRCh38)
Location 15:36714310-36714332
Sequence ATGTATAATCTTATGTTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 415}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125166670 Original CRISPR ATGTATAATCTTATGTTGGT CGG Intronic
900734568 1:4289545-4289567 ATGTATATTCTGTTGTTGGGTGG + Intergenic
905089733 1:35419929-35419951 GTGCATAATCTTATTTTGTTTGG + Exonic
905236094 1:36549795-36549817 ATGTGTATTCTGATGTTGGGTGG + Intergenic
905859266 1:41337470-41337492 ATGTGTATTCTTCTGTTGTTGGG + Intergenic
906018030 1:42600476-42600498 ATGTGTAATCTGCTGTTGTTGGG - Intronic
906895592 1:49767133-49767155 ATGTATATTCTTTGGTTGATTGG - Intronic
907019829 1:51056057-51056079 GTGGATAATCTTCTGTTGTTGGG + Intergenic
907792987 1:57685586-57685608 ATGTATATTCTTTGGTTGTTAGG - Intronic
907864156 1:58382796-58382818 ATTTACCATCTTATCTTGGTAGG + Intronic
908682748 1:66680691-66680713 ATTTATAATCTTGTGCTAGTAGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
909732854 1:78916437-78916459 TTTTATATTCTTATGTGGGTTGG + Intronic
910030329 1:82712948-82712970 ATGTATATTCTTCTTTTGCTGGG + Intergenic
910377732 1:86592033-86592055 ATGTATAATCTTAGCTTGAGGGG + Intergenic
911302234 1:96188834-96188856 ATGTAAAATCTTATCTGTGTTGG - Intergenic
911842360 1:102700033-102700055 ATGTATAATGATATTTTGTTTGG - Intergenic
912611977 1:111057227-111057249 ATGTATATTCTGAAGTTGTTGGG + Intergenic
913429231 1:118771470-118771492 ATGTATATTCTTCAGTTGTTGGG - Intergenic
913493741 1:119407410-119407432 ATGTATATTCTGAAGTTGTTCGG - Intergenic
913666663 1:121055200-121055222 ATAAATAATGTTCTGTTGGTTGG - Intergenic
914018348 1:143842324-143842346 ATAAATAATGTTCTGTTGGTTGG - Intergenic
914656960 1:149750840-149750862 ATAAATAATGTTCTGTTGGTTGG - Intergenic
916392746 1:164348789-164348811 ATGTATATTCTGCTGTTGTTGGG - Intergenic
916417881 1:164609843-164609865 ATGAATAATTTAATGTTGGGGGG + Intronic
916921477 1:169472491-169472513 CTGTATAATCTTTTGTGGATAGG - Intronic
917272287 1:173290758-173290780 ATGTATATTCTGTTGTTGTTGGG - Intergenic
917673374 1:177295824-177295846 ATGTATATTCTGGTGTTGTTGGG + Intergenic
918206908 1:182317581-182317603 ATGTTGAATCTACTGTTGGTTGG - Intergenic
918662301 1:187104876-187104898 ATGAAAAATCTTATGTTGTTGGG + Intergenic
918855498 1:189750502-189750524 ATGTATATTCTGATTTTGTTGGG + Intergenic
919618565 1:199837966-199837988 ATGTATATTCTTCTGTTGTTGGG - Intergenic
920731809 1:208494255-208494277 ATGTATATTCTTTGGTTGATGGG + Intergenic
921336778 1:214095063-214095085 ATGTATATTCTTCTGTTGAGTGG - Intergenic
921839281 1:219811277-219811299 ATTTATAATTTTATCTTGGGAGG - Intronic
922628825 1:227082966-227082988 TTTTAGAATTTTATGTTGGTTGG + Intronic
923146418 1:231201914-231201936 ATGTATAATAGAATGTTGGATGG + Intronic
923477749 1:234351840-234351862 ATGTTTATTCTTCTGTTGTTGGG - Intergenic
924003878 1:239585351-239585373 ATGTTTAAGCTGAGGTTGGTAGG + Intronic
1063359318 10:5437784-5437806 ATGTATAATCTACTGTTGTTGGG - Intronic
1064645946 10:17459806-17459828 ATTTATGATCTTATATTTGTGGG + Intergenic
1064777703 10:18797465-18797487 ATGTATATTCTGTTGTTGTTGGG - Intergenic
1065478009 10:26161884-26161906 ATGTATAATGTGCTGTTGCTGGG - Intronic
1065600778 10:27366161-27366183 ATGTATTAACATATGATGGTTGG + Intergenic
1066632496 10:37470621-37470643 TTGTATAATCTTTTTTTGGGGGG - Intergenic
1067076830 10:43192486-43192508 ATTTATATTTTTATGCTGGTTGG + Intergenic
1067827668 10:49590535-49590557 ATGTGTATTCTTCTGTTGTTGGG + Intergenic
1068262757 10:54604239-54604261 ATGTACAATCTTCTGTTGTTGGG + Intronic
1069186118 10:65425550-65425572 ATGTGTATTCCTATGTTGTTGGG - Intergenic
1069748896 10:70733320-70733342 ATGTAAACTCTTATTATGGTAGG + Intronic
1069844373 10:71360693-71360715 ATGTATACTAGTATTTTGGTAGG - Intronic
1071045770 10:81374550-81374572 ATGTATATTCTTCAGTTGTTGGG + Intergenic
1071812105 10:89194044-89194066 ATGTATATTCTTCAGTTGTTGGG + Intergenic
1071838382 10:89442735-89442757 ATGTATAATATTTGTTTGGTTGG - Intronic
1071881936 10:89908864-89908886 ATGTATAATCTATTGTTTTTGGG + Intergenic
1072390668 10:94982723-94982745 ATATATAATCTGATGTTGTGTGG - Intronic
1072504604 10:96052519-96052541 GTGTACCATCTTAGGTTGGTTGG + Intronic
1073999610 10:109356927-109356949 ATGTATATTCTGTTGTTGATGGG + Intergenic
1074022550 10:109598529-109598551 ATGTATATTCTTCTGTTTTTAGG - Intergenic
1075494007 10:122902750-122902772 ATGTATATTCTGAAGTTGTTGGG - Intergenic
1076929943 10:133525515-133525537 ATATAAAATTTGATGTTGGTTGG + Intronic
1078651483 11:13198429-13198451 ATGTATATTCTGTGGTTGGTGGG - Intergenic
1078771361 11:14355394-14355416 ATGTGTAAAGTTCTGTTGGTAGG - Intronic
1079297512 11:19246261-19246283 AGGTATCATCTGAGGTTGGTGGG - Intergenic
1080423026 11:32128883-32128905 ATGTATATTCTGTTGTTGGATGG - Intergenic
1082638475 11:55626079-55626101 ATGTATATTCTGTTGTTGGGAGG + Intergenic
1083058568 11:59846634-59846656 ATGTAGGATCTTATGTAGGGTGG - Intergenic
1085805382 11:79631369-79631391 ATGTATAATTTTATGGTGTAAGG + Intergenic
1086293177 11:85334888-85334910 ATGTATATTCTGTTGTTGTTGGG + Intronic
1086723853 11:90157053-90157075 ATGTATATTCTGTTTTTGGTTGG + Intronic
1087514544 11:99141949-99141971 ATGTATATTCTTTCGTTGTTTGG + Intronic
1087791950 11:102415358-102415380 ATGTATATTCTGTTGTTGGGTGG - Intronic
1087817142 11:102672007-102672029 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1088026257 11:105187457-105187479 ATGTATATTCTGTTGTTGATGGG - Intergenic
1089928321 11:122282330-122282352 ATTTATAATCTTATGATACTGGG - Intergenic
1090742337 11:129676060-129676082 ATGTATATTCTGCTGTTGATGGG - Intergenic
1091164369 11:133459899-133459921 ATGTATATTCTGTTGTTGCTGGG - Intronic
1092030298 12:5278246-5278268 ATGGAGAATCTTGTGTTGTTGGG + Intergenic
1092116065 12:6007255-6007277 ATGTATAATTTGCTGTTGTTGGG - Intronic
1093064500 12:14642431-14642453 ATGTATAGTTTCATGTTGTTAGG + Intronic
1094758862 12:33504373-33504395 ATGTATATTCTACTGCTGGTAGG + Intergenic
1095167003 12:38984838-38984860 ATATTTAATCTTATATTAGTTGG + Intergenic
1095652581 12:44629929-44629951 AAGTAGAATCACATGTTGGTTGG + Intronic
1097593220 12:61597102-61597124 ATGTATAAACTTATGTTGAAGGG - Intergenic
1098046234 12:66403633-66403655 ATTTATAGTCTTATTTTGGGTGG + Intronic
1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG + Intergenic
1098546065 12:71712228-71712250 ATGTATATTCTACTGTTGTTAGG - Intergenic
1099472278 12:83066086-83066108 ATGTACAATCTAATGTGGGGAGG + Intronic
1099768224 12:87018352-87018374 ATGTGTAATCTGCTGTTGGTTGG - Intergenic
1100928352 12:99576412-99576434 ATGTATATTCTTGTGTTGTTGGG - Intronic
1101275479 12:103196399-103196421 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1103569692 12:121836605-121836627 ATGAATAGTCTTATTTTGGGGGG - Intergenic
1104336309 12:127899139-127899161 ATGTTTAGTCTTGTGTAGGTTGG + Intergenic
1104731805 12:131109695-131109717 ATGTATATTCTGCTGTTGGATGG + Intronic
1105466685 13:20649194-20649216 ATGTACAATCTCCTGTTGTTGGG - Intronic
1106211851 13:27656505-27656527 ATTTATAATCTAATGGGGGTGGG + Intronic
1106939097 13:34756786-34756808 ATGTGTAATCTGTTGTTGCTGGG - Intergenic
1106977866 13:35243924-35243946 ATGTATATTCTGATGTTATTGGG - Intronic
1107797860 13:44072768-44072790 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1108189253 13:47920329-47920351 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1109308857 13:60669248-60669270 ATGTATATTCTGTTGTTGATGGG + Intergenic
1109596872 13:64567990-64568012 ATGTATAGTCTTCAGTTGTTGGG + Intergenic
1109688582 13:65854440-65854462 CTGGATAATTTTTTGTTGGTGGG + Intergenic
1109812863 13:67538254-67538276 TTTTATATTCTTTTGTTGGTTGG - Intergenic
1109924694 13:69120855-69120877 ATGTATATTCTGAAGTTGTTGGG - Intergenic
1110340711 13:74386709-74386731 ATGTATATTCTGAAGTTGTTGGG + Intergenic
1110504936 13:76274359-76274381 ATGTATATTCTGAAGTTGTTGGG - Intergenic
1110724780 13:78808356-78808378 ATTTATAATTTAATCTTGGTAGG + Intergenic
1111019105 13:82423288-82423310 ATGTAGAATTTGATATTGGTGGG - Intergenic
1111384282 13:87503431-87503453 ATGTATATTCTAATGGAGGTAGG + Intergenic
1111580635 13:90218892-90218914 ATGTATATTCTGCAGTTGGTGGG - Intergenic
1111842773 13:93471837-93471859 ATGTATATTCTGCTGTTGTTGGG + Intronic
1111982505 13:95031813-95031835 CTATATTATCTTATGTTAGTTGG + Intronic
1113679414 13:112232782-112232804 ATAGATAATCTTTTGCTGGTTGG + Intergenic
1113845403 13:113386266-113386288 ATGTATATTCTGTGGTTGGTGGG + Intergenic
1114132239 14:19804662-19804684 ATGTATATTCTAATGTTCTTGGG + Intronic
1114833214 14:26170706-26170728 ATGTATATTCTAAAGTTGGTAGG + Intergenic
1115559668 14:34571662-34571684 GTGTATAATATTATAATGGTGGG + Intronic
1118019208 14:61694268-61694290 ATGTTTAATCGTATCTTTGTAGG + Intergenic
1120786527 14:88542820-88542842 AAATATAATGTTAGGTTGGTTGG - Intronic
1123915517 15:25021643-25021665 ACCTTTAATCTTGTGTTGGTAGG - Intergenic
1124084054 15:26530287-26530309 ATGTATATTCTGTTGTTGGATGG - Intergenic
1124474110 15:30016818-30016840 ATGTATAGTCTGTTGTTGGCTGG + Intergenic
1125166670 15:36714310-36714332 ATGTATAATCTTATGTTGGTCGG + Intronic
1125338603 15:38652672-38652694 ATGAATATTTTTATGTTGATAGG - Intergenic
1125370262 15:38968225-38968247 ATGTACAATATTTTGTTGATGGG - Intergenic
1125388207 15:39161639-39161661 ATGTATATTCTTCTGCTGTTGGG + Intergenic
1125455004 15:39848491-39848513 ATGTATATTCTCCTGTTGCTGGG - Intronic
1126496740 15:49299910-49299932 ATGTATATTCTGTTGTTGTTGGG + Intronic
1126545830 15:49873087-49873109 ATGGATAACCTTTTGTTGCTTGG - Intronic
1126927136 15:53602016-53602038 ATGTATAATCTGTTGTTTTTGGG - Intronic
1127014714 15:54671014-54671036 ATGTATATTCTTCAGTTGTTGGG - Intergenic
1130580218 15:85130532-85130554 ATGTATACTCTACTGTTGTTGGG + Intronic
1130658059 15:85806623-85806645 ATGTATATTCTGTTGTTGGAAGG - Intergenic
1130700714 15:86177474-86177496 ATGTATAGTCTGCTGTAGGTGGG - Intronic
1131139648 15:89966771-89966793 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1131326622 15:91453993-91454015 ATGTATATTCTGAGGTTTGTGGG + Intergenic
1131574135 15:93569377-93569399 ATGTACAATATTAGGTTGGCAGG - Intergenic
1131950813 15:97679731-97679753 ATGTACAATGGTATTTTGGTAGG - Intergenic
1132341640 15:101082542-101082564 ATGTATATCCTTATCTTGGAAGG + Intergenic
1134010312 16:10847149-10847171 ATGCAGAATCTTTTGGTGGTAGG + Intergenic
1138924454 16:61574162-61574184 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1139132124 16:64159116-64159138 ATGTATAAGTCTGTGTTGGTGGG + Intergenic
1144380477 17:14691503-14691525 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1149215958 17:54354586-54354608 ATGTATATTCTGATGTTGTTGGG + Intergenic
1150312635 17:64141457-64141479 ATGTGTATTCTTTTGTTGTTGGG - Intergenic
1150514513 17:65794171-65794193 ATGTATAGTCTTCTGTTGTAGGG + Intronic
1150965938 17:69968371-69968393 GTGTAAAATCTAATGGTGGTGGG + Intergenic
1151410433 17:73923067-73923089 ATGTATATTCTTCTATTGTTGGG - Intergenic
1155327525 18:24680270-24680292 ATTTATACTCTCATCTTGGTAGG + Intergenic
1155614763 18:27708822-27708844 ATGTATATTCTGTTGTTTGTTGG + Intergenic
1155677677 18:28449409-28449431 ATGCATAAAAATATGTTGGTAGG - Intergenic
1156319136 18:36001901-36001923 ATATATAATTCTAAGTTGGTGGG + Intronic
1156562520 18:38143439-38143461 ATGTGTATTCTGCTGTTGGTTGG + Intergenic
1156667708 18:39427945-39427967 ATGTATATTCTGAAGTTGTTGGG - Intergenic
1156755798 18:40523618-40523640 ATGTATATGCACATGTTGGTGGG - Intergenic
1157045378 18:44096907-44096929 ATGTATATTCTTTGGTTGTTGGG + Intergenic
1157162920 18:45331012-45331034 ATGTATTTTCTTATGTTCCTTGG - Intronic
1158250142 18:55478884-55478906 ATGTTAAATATTATATTGGTGGG + Intronic
1159978738 18:74750250-74750272 ATTTTGCATCTTATGTTGGTAGG - Intronic
1160071649 18:75634389-75634411 ATATATAATATAATGTTTGTAGG - Intergenic
1163886342 19:19968373-19968395 ATGTATATTCTGAAGTTGTTGGG + Intergenic
1168555512 19:57335859-57335881 ATGTATATTCTGGTGTTGTTTGG + Intergenic
925821829 2:7806254-7806276 ATGTATCATCATCTGTTTGTGGG - Intergenic
926387812 2:12354632-12354654 ATGAAAAAGCTTATGTTTGTGGG - Intergenic
927069730 2:19514921-19514943 ATGTATATTCTTCAGTTGTTTGG + Intergenic
927343519 2:22009917-22009939 ATATACAATTTTATCTTGGTGGG + Intergenic
927522852 2:23711073-23711095 ATGTATATTTTTATGATTGTGGG + Intergenic
928143806 2:28753003-28753025 TTGAATAGTTTTATGTTGGTGGG + Intronic
928479912 2:31672610-31672632 ATGTATATTCTTCAGTTGTTGGG + Intergenic
928559923 2:32471161-32471183 GTTTATAATAATATGTTGGTGGG + Intronic
928636991 2:33257023-33257045 ATGTATATTCTGATTTGGGTAGG + Intronic
928799532 2:35070171-35070193 ATGTATATTCTGTGGTTGGTGGG - Intergenic
928852338 2:35764617-35764639 ATGTATATTTTTCTGTTGTTGGG - Intergenic
929077311 2:38088632-38088654 ATGTACATTCTTTTGGTGGTGGG - Intronic
929372153 2:41238737-41238759 ATGTGTAATCTGTTGCTGGTTGG + Intergenic
930433420 2:51310713-51310735 ATGTATAGTCTGTTGTTGTTTGG - Intergenic
930512528 2:52363671-52363693 ATGTGTATTCTGATGTTGATGGG + Intergenic
930541589 2:52713326-52713348 ATGTAGAATCATATGTATGTGGG - Intergenic
930906732 2:56577726-56577748 ATGTATATTCTTCAGTTGTTAGG - Intergenic
931175163 2:59847025-59847047 ATGCAAAATCTTCTGATGGTTGG + Intergenic
932883875 2:75529425-75529447 ATGTATATTCTGTTGTTGTTGGG - Intronic
934012416 2:87837250-87837272 ATGTATATTCTGTTGTTGTTGGG - Intergenic
934631565 2:95930633-95930655 ATGTATTATGTCATATTGGTTGG - Intronic
934802082 2:97174052-97174074 ATGTATTATGTCATATTGGTTGG + Intronic
934833727 2:97562226-97562248 ATGTATTATGTCATATTGGTTGG - Intronic
935257558 2:101325235-101325257 ATATATAAAATTATGTTGATGGG - Intergenic
935475227 2:103512169-103512191 ATGTATATTCTGCTGTTGGCTGG + Intergenic
935491866 2:103731426-103731448 ATGTATTTTCTATTGTTGGTTGG + Intergenic
935863182 2:107356646-107356668 ATGTATAAAATTCTGCTGGTAGG + Intergenic
936000400 2:108822479-108822501 ATGTATCATCTGCTGTTGTTGGG - Intronic
936340600 2:111628890-111628912 ATGTATATTCTGCTGTTGTTGGG - Intergenic
936741553 2:115517417-115517439 ATGTATAATTTAATCTTAGTTGG + Intronic
936990606 2:118360987-118361009 ATGTATATTCTGCTGTTGTTGGG + Intergenic
937329485 2:121017405-121017427 ATGTATATTTTTATGTTAGTTGG - Intergenic
939494644 2:142913657-142913679 ATGTATAATCTGTGGTTGATGGG + Intronic
939892055 2:147747945-147747967 ATGAATAATCTGATTGTGGTGGG - Intergenic
941420016 2:165272541-165272563 ATGTATATTCTGAAGTTGTTGGG - Intronic
942585868 2:177476629-177476651 ATGTACATTCTTCTGTTGTTGGG + Intronic
943593042 2:189821960-189821982 ATTGATAATCTTACATTGGTTGG - Intronic
944007541 2:194928521-194928543 ATTTTTAATGTTTTGTTGGTAGG - Intergenic
944027563 2:195189916-195189938 ATGTATATTCTTCAGTTGTTTGG - Intergenic
945589495 2:211712490-211712512 ATAGATAATTTTATGTTGTTAGG - Intronic
945790727 2:214302242-214302264 ATGTATATTCTGAAGTTGTTGGG + Intronic
945802898 2:214455662-214455684 GGGGATTATCTTATGTTGGTTGG - Intronic
946634796 2:221712804-221712826 ATGTATATTCTTTTTTTGGGGGG - Intergenic
946656402 2:221952755-221952777 ATGCATAATCTTGTGGGGGTGGG - Intergenic
946662924 2:222020242-222020264 ATGAAAAGTATTATGTTGGTGGG + Intergenic
946942803 2:224787409-224787431 ATGTAAAATCTTATTTTGATTGG - Intronic
948451464 2:238076924-238076946 ATGTATATTCTGCTGTTGTTGGG + Intronic
1169835871 20:9878161-9878183 ATGTATAGTCTACTGTTGTTAGG - Intergenic
1170660995 20:18339763-18339785 ATGTGTAATCTGCTGTTGTTGGG - Intergenic
1170766793 20:19296772-19296794 ATGTATAATCTGTTGTTTTTAGG - Intronic
1171061124 20:21961375-21961397 ATGTATATTCTGGTGTTGCTTGG + Intergenic
1173740515 20:45397080-45397102 ATGTTTATTCTGCTGTTGGTGGG + Intronic
1174781516 20:53393316-53393338 TTTAATAATTTTATGTTGGTGGG - Intronic
1174793350 20:53500994-53501016 ATGTTTAATTTTATGTTCTTTGG + Intergenic
1175208906 20:57335943-57335965 ATGTATACTGTTATGGTGATTGG + Intronic
1175253698 20:57625407-57625429 ATGTATTATCTCATGGTGGAAGG + Intergenic
1175662701 20:60829599-60829621 ATGTGTATTCTGATGTTGTTGGG + Intergenic
1179087613 21:38232913-38232935 ATGTATATTCTACTGTTTGTGGG + Intronic
1180567474 22:16685779-16685801 ATGTATAATTTGCTGTTGTTGGG - Intergenic
1182706906 22:32288486-32288508 ATGCAAAATCTAATGTGGGTTGG - Intergenic
1183920926 22:41167630-41167652 ATATATAATGTTTGGTTGGTTGG + Intronic
949216229 3:1571313-1571335 ATGTATATTCTACTGTTTGTTGG + Intergenic
949376663 3:3398175-3398197 ATGTATATTCTGATGTTATTGGG + Intergenic
949898415 3:8789598-8789620 ATGTGTATTCTTCTGCTGGTGGG + Intronic
950561362 3:13729486-13729508 ATGTATAGTCTGCTGTTGTTGGG + Intergenic
951163621 3:19457851-19457873 GTGTATTATTTTATCTTGGTTGG + Intronic
951418646 3:22456574-22456596 ATGAATAAGCCTATGTTGCTCGG + Intergenic
951458012 3:22915191-22915213 ATGTATAATTTTATTTTGGGTGG - Intergenic
951623835 3:24637971-24637993 ATATAGAATTCTATGTTGGTGGG + Intergenic
951758734 3:26120909-26120931 ATGTATATTCTTTGGTTGTTGGG - Intergenic
952596587 3:35026321-35026343 ATGTCTAATTTTATCTTGCTTGG + Intergenic
952716644 3:36486525-36486547 ATATGTTATCTAATGTTGGTGGG - Intronic
953560795 3:43990940-43990962 ATGTATATTCTGCTGTTGTTGGG - Intergenic
953570791 3:44069960-44069982 ATTTATAATCTTTTTTTCGTGGG - Intergenic
954436520 3:50499128-50499150 AGGTAGAATCTGATGTGGGTGGG + Intronic
954588496 3:51758760-51758782 ATGTATATTCTTCTGCTGTTGGG + Intergenic
956117381 3:65932211-65932233 TTGCATTATTTTATGTTGGTTGG - Intronic
957136149 3:76291977-76291999 ATGTATATTCTCTTGTTGGGTGG + Intronic
957668278 3:83265799-83265821 ATGTATATTCTTCTGTTGTTGGG - Intergenic
957728333 3:84097843-84097865 ATGTATAATCAAATGTTAATAGG + Intergenic
957831333 3:85524592-85524614 ATGTATAATCTACTGCTGTTGGG + Intronic
958462895 3:94420963-94420985 ATGTATATTCTGTTGTTGGGAGG - Intergenic
958464919 3:94445447-94445469 ATGTATATTCTGTTGTTTGTGGG - Intergenic
958817786 3:98935321-98935343 ATGTATATTCTGTTGTTGTTGGG - Intergenic
958818783 3:98948914-98948936 ATGTATATTCTGCTGTTGTTGGG + Intergenic
959413363 3:106052852-106052874 ATATGTTATCTTCTGTTGGTTGG - Intergenic
959460437 3:106618992-106619014 CCGTATAATATTTTGTTGGTGGG + Intergenic
959499344 3:107087662-107087684 ATATATAATCAAATGTTGATAGG - Intergenic
959960287 3:112290519-112290541 ATGTATACTCTTTTGTTTTTGGG + Intronic
960213681 3:115003200-115003222 TTGTATGATATTATGATGGTGGG + Intronic
960560143 3:119074193-119074215 ATGTATATTCTGTTGTTGTTGGG - Intronic
965256595 3:166421923-166421945 ATGTATATTCTGTTGTTTGTGGG + Intergenic
965892002 3:173526063-173526085 ATGTATATTCTGTTGTTGTTGGG + Intronic
969661481 4:8532112-8532134 ATTTAAAATTTTATGTTGTTAGG + Intergenic
971013618 4:22465182-22465204 ATGTTTAATTTTCTTTTGGTTGG + Intronic
971557450 4:28032249-28032271 ATGTATATTCTATTGTTGTTGGG + Intergenic
971665853 4:29483648-29483670 CTGTTTAATATTAGGTTGGTTGG + Intergenic
972441088 4:39092622-39092644 ATGTATATTCTGGTGTAGGTCGG + Intronic
972997420 4:44898196-44898218 ATGTATAATCTCATTTTCTTGGG + Intergenic
973034390 4:45388252-45388274 ATGTATACTCTGTTGTTGTTGGG + Intergenic
973800026 4:54468573-54468595 ATATAGAATTCTATGTTGGTGGG + Intergenic
974499173 4:62676212-62676234 ATGTGTAACCTGCTGTTGGTGGG + Intergenic
975967270 4:79988671-79988693 ATGTATATTCTGTTGTTGTTGGG - Intronic
976082372 4:81369759-81369781 ATGTACCATATTATGTTTGTTGG + Intergenic
976459566 4:85293573-85293595 ATGTGTATTCTGATGTTGGATGG - Intergenic
976460953 4:85312043-85312065 ATGTATATTCTATTGTTGTTGGG + Intergenic
976640488 4:87332700-87332722 ATGTATATTCTGTTGTTCGTGGG + Intergenic
978107782 4:104925238-104925260 TTATATCATCTTATCTTGGTTGG + Intergenic
978363485 4:107956139-107956161 ATGTATATTCTTCTGTTGGATGG - Intergenic
979202041 4:117990161-117990183 ATGTATATTCTTCAGTTGTTGGG - Intergenic
979461055 4:120984625-120984647 ATGTATATTCTGCTGTTGTTGGG + Intergenic
979880532 4:125952453-125952475 ATTTTTAATCTGATGTTGTTAGG + Intergenic
979907115 4:126308536-126308558 ATGTATATTCTGTTGTTGGGTGG + Intergenic
980159929 4:129148564-129148586 AAGTATCATCATATGTTGGAAGG - Intergenic
980342175 4:131564906-131564928 ATGAATCATCTTATGCTGCTAGG + Intergenic
980475419 4:133308283-133308305 ATGTATAATCTTCCATTGTTTGG + Intergenic
980580859 4:134748045-134748067 ATGTATACTCTGTTGTTGTTGGG - Intergenic
981939506 4:150267218-150267240 ATGTATATTCTATTGTTGTTGGG - Intronic
982894746 4:160904966-160904988 ATGTATAATTTTCTGTTTATAGG - Intergenic
983303741 4:165959519-165959541 ATGTATATTCTTTAGTTGTTGGG - Intronic
984306836 4:178003657-178003679 ATGTAGAAAATAATGTTGGTGGG - Intergenic
984906060 4:184626789-184626811 ATGTATACTCTCCCGTTGGTGGG - Intergenic
986074562 5:4321936-4321958 ATTTATAATTTAATCTTGGTAGG - Intergenic
986244618 5:5995540-5995562 ATATATATTCTTTTGTTGTTGGG + Intergenic
987030192 5:13969770-13969792 ATGTATAATCTGTAGTTGTTGGG + Intergenic
988332677 5:29863023-29863045 ATGTATATTCATTTGTTGTTGGG - Intergenic
988356838 5:30187597-30187619 ATGTATTATCTGATGTGGTTTGG + Intergenic
989185225 5:38617913-38617935 ATGTGTATTCTTCTGTTGTTAGG + Intergenic
989495299 5:42105019-42105041 ATGTATATTCTATTGTTGTTGGG + Intergenic
989515154 5:42334472-42334494 ATGTGTATTCTGATGTTGTTAGG - Intergenic
990134394 5:52627929-52627951 ATGTACATTCTGATGTTGTTGGG + Intergenic
990720124 5:58685238-58685260 CTGTATTATCTTATGTTCTTGGG + Intronic
990857287 5:60282977-60282999 ATGTATATTCTGCTGTTGTTGGG + Intronic
991347102 5:65680948-65680970 ATATAGAATCTTAAGTTGGAGGG - Intronic
994318135 5:98358409-98358431 ATGTATATTCTGTTGTTGTTGGG + Intergenic
994342571 5:98648588-98648610 ATGTAATATTATATGTTGGTGGG - Intergenic
995160898 5:108980260-108980282 ATGTATAAATTTATACTGGTAGG + Intronic
995450904 5:112299493-112299515 ATGTATATTCTGAAGTTGTTGGG + Intronic
995594923 5:113737766-113737788 ATGTATATTCTAATCTTGTTGGG - Intergenic
996195665 5:120604017-120604039 ATGTATAATCTGTTGTTGTTGGG + Intronic
996791029 5:127293093-127293115 ATGTATAAACTTGTGTTGAGAGG + Intronic
997006577 5:129823823-129823845 ATGTATATTCTTTAGTTGTTGGG - Intergenic
999066300 5:148689652-148689674 ATGTATATTCTGTAGTTGGTGGG - Intergenic
999741169 5:154553984-154554006 ATGTATTATCTTTTTTTAGTGGG + Intergenic
1000134577 5:158334836-158334858 ATGTATATTCTGTTGTTGGGTGG + Intergenic
1000447165 5:161336312-161336334 ATGTATAATGTTATAATGTTGGG + Intronic
1001161138 5:169315408-169315430 ATGTCTATTCTTCTGTTGCTGGG - Intergenic
1003301607 6:4889039-4889061 ATGTATATTCTGCTGTTGTTGGG + Intronic
1003883767 6:10502259-10502281 ATGTATATTCTCATATTGTTGGG + Intronic
1004039125 6:11958524-11958546 CTATATAATTTTATGTTGGAAGG + Intergenic
1004053879 6:12114693-12114715 ATGTATAATGTTATGTTAAGTGG + Intronic
1004636918 6:17478053-17478075 ATATAAAATTTTATGTTGCTTGG + Intronic
1006234817 6:32620106-32620128 ATGTAAAATCATATGTATGTTGG + Intergenic
1006864313 6:37196524-37196546 ATGTATATTCTATTGTTGTTGGG - Intergenic
1007439854 6:41849476-41849498 ATGTATATTCTGCTGTTGTTAGG - Intronic
1008226441 6:48923359-48923381 ATTTATAAACTTATGTTTATTGG + Intergenic
1009706907 6:67264066-67264088 ATGTATATTCTGTTGTTTGTGGG + Intergenic
1010565373 6:77405465-77405487 ATGTGTATTCTTCTGTTGGATGG + Intergenic
1010820094 6:80405002-80405024 ATGTGTACTCTTCTGTTGGATGG + Intergenic
1010978688 6:82345483-82345505 ATGTATATTCTGCTGTTGTTAGG + Intergenic
1011707439 6:90015727-90015749 ATGTATATTCTGTTGTTGGCTGG + Intronic
1011985846 6:93444594-93444616 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1012345088 6:98175523-98175545 ATGTATAATCTGTTGTTTGGTGG - Intergenic
1012570797 6:100725503-100725525 ATGTATAAGCTTATTTTGAAGGG - Intronic
1012715166 6:102659878-102659900 ATTTATCATCTTTTGTTGGTTGG - Intergenic
1013983637 6:116164059-116164081 ATGTATATTCTTTGGTTGTTGGG + Intronic
1014811917 6:125896283-125896305 AAGGATACTCTTATGCTGGTGGG - Intronic
1015345815 6:132157311-132157333 ATGTGTAATCTGCTGTTGGGGGG - Intergenic
1016153692 6:140776869-140776891 ATGTATAATATCATCTTGGCCGG - Intergenic
1016909910 6:149188277-149188299 ATGTATATTCTTCAGTTGTTGGG + Intergenic
1020969406 7:14915689-14915711 ATATAGAATCCTAGGTTGGTGGG - Intronic
1023657905 7:42444770-42444792 ATGTATATTCTGTTGTTGTTTGG + Intergenic
1024168777 7:46762767-46762789 ATGCATATACTTGTGTTGGTTGG - Intergenic
1027507992 7:79042763-79042785 ATGTATATTCTGTTGTTGGGTGG - Intronic
1028281436 7:88934618-88934640 ATGTTTTTTCTTATGTTTGTTGG - Intronic
1028518352 7:91701889-91701911 ATGTATAGTCTTTTGTTTGGAGG - Intronic
1028765151 7:94547918-94547940 ATGTATAATCCTATGCCGTTTGG + Intronic
1030170375 7:106595919-106595941 ACGTATAATCATATGTTGGAAGG - Intergenic
1030786252 7:113666810-113666832 ATGTTTATTCTTCTGTTGTTGGG - Intergenic
1030813199 7:114002021-114002043 ATGTATATTCTGTTGTTGTTGGG - Intronic
1031645859 7:124224150-124224172 ATGTATTATCTTATTCTGGTTGG - Intergenic
1032778532 7:135142010-135142032 ATGTATATTCTGTTGTTGTTGGG + Intronic
1033412666 7:141133046-141133068 ATCTATAATGTTATTTGGGTAGG - Intronic
1033517009 7:142116809-142116831 ATGTATCCTCTTAGATTGGTGGG + Intronic
1033706651 7:143893446-143893468 ATGTATATTCTGTTGTTGGTAGG - Intronic
1039626406 8:39059148-39059170 GTGTAGAATATTATGATGGTGGG + Intronic
1040462258 8:47660358-47660380 CTGTATTATTTTATGTTGCTGGG + Intronic
1041054573 8:53970513-53970535 ATGTATAACATTATTTGGGTTGG - Intronic
1042337267 8:67641190-67641212 CTGTTTAATTTTATCTTGGTAGG - Intronic
1043104184 8:76087491-76087513 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1043210822 8:77514374-77514396 AAATATAATCTTATATTGGGTGG + Intergenic
1043658674 8:82706931-82706953 ATGTTAAATGTTATGTTGGCAGG + Intergenic
1043809910 8:84726326-84726348 ATATATAATTTTATTTTTGTAGG + Intronic
1044334612 8:90965532-90965554 ATGTATATTCTGCTGTTGTTGGG - Intronic
1044768227 8:95599954-95599976 ATGTATATTCTGTTGTTGGCTGG - Intergenic
1044793762 8:95874808-95874830 ATGTATATTCTGTTTTTGGTTGG - Intergenic
1045814070 8:106259255-106259277 ATGTATATTCTGAAGTTGTTGGG + Intergenic
1046959881 8:120099940-120099962 ATGTATATTCTGTTGTTGTTGGG + Intronic
1047395953 8:124499150-124499172 ATCTATAATTTTATTTTAGTAGG + Intronic
1048102732 8:131371798-131371820 ATGTATAGTCTTTTGTTGTTAGG - Intergenic
1048413932 8:134205316-134205338 ATGTAAAATCTAATTTTGGGGGG - Intergenic
1049027049 8:139999596-139999618 ATGTATATTCTGCTCTTGGTGGG - Intronic
1049168089 8:141139390-141139412 ATGCATAATCTTAGGTTTCTGGG + Intronic
1050498918 9:6273500-6273522 ATGTATATTCTGCTGTTGTTAGG - Intergenic
1051132670 9:13880013-13880035 ATGTAAATTCTTATGTCTGTTGG - Intergenic
1051136642 9:13930219-13930241 CTGAATAATCTGATGTTGCTTGG - Intergenic
1051885925 9:21892803-21892825 ATGTATATTCTGTTGTTGTTGGG - Intronic
1052703251 9:31962836-31962858 ATGTATATTCTTTTGTTTTTGGG - Intergenic
1052872558 9:33523040-33523062 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1054703698 9:68440259-68440281 GTGTATATTCTGCTGTTGGTTGG - Intronic
1054859919 9:69940172-69940194 ATGTATATTCTGTTGTTGTTAGG - Intergenic
1055131561 9:72780994-72781016 ATGTATATTCTGTTGTTGTTGGG - Intronic
1055337710 9:75249463-75249485 ATGTATATTCTGTTGTTGGGTGG + Intergenic
1055532363 9:77197225-77197247 ATGTGTATTCTGCTGTTGGTGGG + Intronic
1055908843 9:81324856-81324878 ATGTATATTCTGGTGTTGGCTGG + Intergenic
1056345222 9:85687396-85687418 ATGTATATTCTGCTGTTGTTGGG - Intronic
1056527673 9:87458378-87458400 CTGTAGAATACTATGTTGGTGGG + Intergenic
1056879273 9:90374944-90374966 ATGTATATTGTGCTGTTGGTGGG - Intergenic
1058913567 9:109543507-109543529 ATGTATATTCTTCTGTTGTTGGG + Intergenic
1059705586 9:116820438-116820460 AAGTATAACCTTCTGTTGGGTGG - Intronic
1060027175 9:120183180-120183202 ATCTAGTGTCTTATGTTGGTTGG + Intergenic
1060502294 9:124169519-124169541 ATATATATTCTTCTGTTGCTGGG + Intergenic
1186679060 X:11852930-11852952 ATGTATATTCTTCTGTTTGAGGG - Intergenic
1187801684 X:23070524-23070546 ATGTATATTCTGTTGTTGTTGGG - Intergenic
1188185308 X:27107351-27107373 AAGTATATTCTTAAGTTGGGTGG - Intergenic
1188756797 X:33972432-33972454 ATGTATATTCTGCTGTTGCTGGG + Intergenic
1189002452 X:36960928-36960950 ACTAATAATATTATGTTGGTTGG - Intergenic
1189435085 X:40985548-40985570 ATGTATATTCTGCTGTTGTTGGG - Intergenic
1189871635 X:45390298-45390320 AGGTGTAATATTATGTTGTTAGG + Intergenic
1190020733 X:46871655-46871677 ATGTGTAATCTGCTGTTGCTTGG + Intronic
1190469179 X:50760022-50760044 ATGTATATTCTTCTGTGGTTGGG + Intronic
1191017333 X:55823478-55823500 ATGTTTATTCTTTTGTTGTTGGG + Intergenic
1191021989 X:55871188-55871210 ATGTATATTCTTCTGCTGTTGGG - Intergenic
1191067478 X:56365889-56365911 ATGTATATTCTGCTGTTGTTGGG + Intergenic
1191642269 X:63439317-63439339 ATGTATATTCTTCAGTTGTTGGG - Intergenic
1191944090 X:66512309-66512331 ATGTATACTCTGTTGTTGTTGGG + Intergenic
1192120676 X:68452368-68452390 ATATATATTCTTGTGTTTGTTGG - Intergenic
1192756611 X:74052519-74052541 ATGTATATTCTAATTTTGTTGGG - Intergenic
1192920356 X:75699564-75699586 ATGTATATTCTACTGTTGTTCGG - Intergenic
1193678401 X:84485206-84485228 ATGTATAGTCTGCTGTTGGGTGG + Intronic
1193879634 X:86906259-86906281 ATGCATATTCTGATGTTGGATGG - Intergenic
1194001613 X:88436671-88436693 ATGCATAATCTTCAGTTGTTGGG - Intergenic
1194069822 X:89308711-89308733 ATGTGTATTCTGATGTTAGTAGG + Intergenic
1194132868 X:90103952-90103974 ATGTATATTCTTTTGTTTGAGGG + Intergenic
1194183909 X:90747854-90747876 ATGTGTATTCTTCGGTTGGTGGG + Intergenic
1194354076 X:92858891-92858913 ATGTATATTCTGAGGTTGTTGGG - Intergenic
1194404004 X:93471225-93471247 ATGTATATTCTGAGGTTGTTAGG - Intergenic
1194564242 X:95463618-95463640 ATGTATATTCTGTTGTTGGGTGG - Intergenic
1194835674 X:98679532-98679554 ATTTATAATATAATGTTGGGGGG + Intergenic
1195309641 X:103618969-103618991 ATGTATATTCTTTTGTTGGGTGG - Intronic
1195415384 X:104614486-104614508 ATGTATATTCTGAGGTTGATGGG + Intronic
1195502709 X:105620932-105620954 GGGTCCAATCTTATGTTGGTTGG - Intronic
1196024371 X:111024825-111024847 ATGTATATTCTGAAGTTGTTGGG - Intronic
1196994467 X:121366394-121366416 ATGTATATTCTTCTGTTGTTGGG + Intergenic
1197014005 X:121602337-121602359 ATGTATATTCTTTTGTTTTTGGG + Intergenic
1197021390 X:121693785-121693807 ATGTATACTTATATGTTGTTGGG + Intergenic
1197066942 X:122244953-122244975 AAGTATAATGTTAAGTCGGTAGG + Intergenic
1197109156 X:122752312-122752334 ATGTATATTCTGCTGTTGTTAGG + Intergenic
1197563932 X:128057698-128057720 ATTAATAATCTAGTGTTGGTTGG - Intergenic
1197565130 X:128074511-128074533 ATATATATTCTTTTGTTGTTGGG - Intergenic
1197640528 X:128962130-128962152 ATGTGTATTCTTCTGTTGTTGGG - Intergenic
1197731751 X:129816638-129816660 ATTTATATTCTTATTTTGATAGG - Intronic
1198325083 X:135562464-135562486 ATGTATGGTCTCATGTTGTTTGG + Intronic
1198327523 X:135588353-135588375 ATGTATAGTCTGGTGTTGTTGGG - Intergenic
1198807715 X:140506534-140506556 AAGCATAATCTTAAGTGGGTGGG + Intergenic
1198952331 X:142085795-142085817 ATGGAGAATATTATGTTGGAAGG - Intergenic
1199132058 X:144201241-144201263 ATGTATATTCTGTTGTTGTTGGG + Intergenic
1199242017 X:145557930-145557952 ATGTACATTCTTCTGTTGTTGGG - Intergenic
1199252817 X:145683763-145683785 CTGTATAATCTCAAGTTGGGGGG - Intergenic
1199905060 X:152218422-152218444 ATGTTCAGTCTTATGTTGTTTGG + Intronic
1199973311 X:152876464-152876486 ATGTATTATCTTATAGTTGTGGG + Intergenic
1200341143 X:155397049-155397071 ATATATAATATTATGTAGGCTGG - Intergenic
1200478656 Y:3674032-3674054 ATGTATATTCTTTTGTTTGAGGG + Intergenic
1200530504 Y:4329785-4329807 ATGTGTATTCTTCGGTTGGTGGG + Intergenic
1200554513 Y:4618779-4618801 ATATATATTCTGTTGTTGGTGGG - Intergenic
1200662429 Y:5975910-5975932 ATGTATATTCTGAGGTTGTTGGG - Intergenic
1200723971 Y:6642847-6642869 ATGTGTATTCTGATGTTAGTAGG + Intergenic