ID: 1125172007

View in Genome Browser
Species Human (GRCh38)
Location 15:36776272-36776294
Sequence TGTATTGGAGAGAATATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125172000_1125172007 24 Left 1125172000 15:36776225-36776247 CCTCACAGATTTAGGATATGTCA 0: 1
1: 0
2: 0
3: 20
4: 187
Right 1125172007 15:36776272-36776294 TGTATTGGAGAGAATATTCAGGG 0: 1
1: 0
2: 1
3: 24
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125172007 Original CRISPR TGTATTGGAGAGAATATTCA GGG Intronic
901119816 1:6882008-6882030 TGTAGTGCAGAGAATCTTCCAGG + Intronic
905253856 1:36667054-36667076 TGTATTTGAGAAAACATTAAAGG - Intergenic
906869418 1:49461168-49461190 TATATTTGAGGGAATAATCAAGG - Intronic
906898458 1:49806590-49806612 TGTTTGGGAGAGAATACTAATGG + Intronic
908316089 1:62933959-62933981 TGTATTGGAGAAATTTTTCAAGG - Intergenic
908920097 1:69179977-69179999 TGTGTTGGGGAAAATAGTCATGG + Intergenic
908951327 1:69567058-69567080 TGTGTCAGAGAGAATGTTCATGG + Intergenic
909187381 1:72505173-72505195 TCCATTGAAGAGAATACTCAAGG - Intergenic
909218399 1:72921556-72921578 TGTTTTAGAAAAAATATTCATGG + Intergenic
911523024 1:98951282-98951304 TGAATAGGAAAGAATATGCATGG + Intronic
911753148 1:101522118-101522140 TCTATTGGATATAATATACAAGG - Intergenic
913972903 1:143429454-143429476 TGTATTTGGGGGAATAATCAAGG - Intergenic
914067287 1:144255061-144255083 TGTATTTGGGGGAATAATCAAGG - Intergenic
914111866 1:144711293-144711315 TGTATTTGGGGGAATAATCAAGG + Intergenic
914294927 1:146311984-146312006 TGTTGTGGAGACAATATTTAAGG - Intergenic
914555968 1:148762767-148762789 TGTTGTGGAGACAATATTTAAGG - Intergenic
915192648 1:154164579-154164601 TTTCTAGGAGAGAATAATCAGGG - Intronic
916314722 1:163436570-163436592 AGAATTGGAGATAATATACAGGG + Intergenic
917243329 1:172973321-172973343 GGAATTGGAGAGGAGATTCAGGG - Intergenic
919192454 1:194240477-194240499 TGTATTGGGGAAAATGTTAAAGG - Intergenic
920658660 1:207896343-207896365 TGCATTGGAAAGAATGTACAGGG - Intronic
920800081 1:209178174-209178196 TATATTTGAGGGAATAATCAAGG + Intergenic
921371559 1:214428249-214428271 TGTATGGGAGAAAGAATTCAAGG + Intronic
921532750 1:216306081-216306103 TCTATTTGAGGGAATAATCAAGG - Intronic
921971755 1:221156805-221156827 TGGATTTAAGAGAATATTCAGGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1064153362 10:12884037-12884059 TATATTGGAGAGAATGCACAGGG + Intergenic
1064478442 10:15716600-15716622 TGTATGGGAGAGTGAATTCAAGG + Intronic
1064853123 10:19733157-19733179 AGAAATGGAGAGAATATTCATGG + Intronic
1064904399 10:20330275-20330297 TGTTTAGGAGAGAATATCCAGGG + Intergenic
1065671036 10:28117695-28117717 TTTATGTGAGACAATATTCAAGG + Intronic
1068864253 10:61878330-61878352 GGTATTGGAGAAATTGTTCAAGG + Intergenic
1070687490 10:78499746-78499768 AGAATTGGTGAGTATATTCATGG - Intergenic
1071417709 10:85456594-85456616 TGTTTAGAAGAGAATATTCCAGG - Intergenic
1071780822 10:88842488-88842510 TGAATTGAAGAAAATAATCAAGG - Intronic
1073184170 10:101605639-101605661 TGTGTTGGAGAGAGTACCCAGGG + Intronic
1073829610 10:107367191-107367213 TGTAATGGAGAGAAAATTCCAGG - Intergenic
1074435504 10:113430927-113430949 TGTATTGGAGAGAAGAGAAAAGG + Intergenic
1078455731 11:11473322-11473344 TGTATAGAAGAGCATATTCTGGG - Intronic
1078696647 11:13639754-13639776 TGTACTGGACAGTATAGTCAGGG - Intergenic
1079279617 11:19075573-19075595 TATATTAGAGAAAATTTTCATGG - Intergenic
1080221607 11:29912065-29912087 TGTATGAGAAAGAATTTTCAAGG + Intergenic
1086639615 11:89136837-89136859 GGTATTGTAGAGAATACACAGGG + Intergenic
1087421691 11:97934976-97934998 TGTATAGAAGAAAAAATTCAAGG - Intergenic
1087484137 11:98740081-98740103 TGTATTGGACAGAATTTCTAAGG - Intergenic
1087804466 11:102540429-102540451 CGTATTTGAGGGAATAATCAAGG + Intergenic
1088461608 11:110089277-110089299 TATATTGGGAAGAATTTTCATGG - Intergenic
1089406936 11:118205415-118205437 TGTGATGGAGGGAATTTTCATGG - Intronic
1089949694 11:122514108-122514130 TGATTTAGAGAAAATATTCAAGG + Intergenic
1090810974 11:130242735-130242757 TACATTGTAGAGAAAATTCAGGG - Intronic
1091310326 11:134570456-134570478 TGTATTGGATATAAAATTCTGGG - Intergenic
1091998332 12:5013212-5013234 TAAATTGGAGAGAAAAGTCAAGG + Intergenic
1092027664 12:5256552-5256574 TCTCTTGGAAAGAATAATCATGG - Intergenic
1093034242 12:14318078-14318100 TGTATTTAGGAGAATAATCAAGG + Intergenic
1093948516 12:25136984-25137006 TATATTTGAAAGAATAATCAAGG + Intronic
1093974350 12:25404781-25404803 TGTTTTGTATATAATATTCAGGG - Intergenic
1094099552 12:26746702-26746724 AGCAGTGGAGAGAATTTTCAAGG + Intronic
1096530246 12:52238026-52238048 TGTATTGAAGAGAATCTTAAAGG - Intronic
1097482020 12:60140159-60140181 TGTTTTGGAGAGAAAGATCACGG + Intergenic
1098034766 12:66290386-66290408 TGTTTTGGAGAGATTATTGTTGG - Intergenic
1098934230 12:76459363-76459385 TGAATTGGATATAATTTTCAAGG + Intronic
1100267005 12:92986949-92986971 TGTATTAAATAGAATAGTCATGG - Intergenic
1100915783 12:99420168-99420190 TGTAATGGAAAGTGTATTCATGG - Intronic
1104067236 12:125316053-125316075 CTTGTTGGAGAGAACATTCAGGG - Intronic
1105908414 13:24836282-24836304 TGTATTTGGGGGAATAATCAAGG + Intronic
1106016663 13:25875803-25875825 TGTTTTGGAGATGATATTAAAGG + Intronic
1106547058 13:30739869-30739891 TGAATTGGAGGCAATATGCATGG - Intronic
1106624383 13:31405551-31405573 TGGATTAAAGAGAATATTGACGG + Intergenic
1108915671 13:55607608-55607630 TGTTTTGCAGAGAAGGTTCAGGG + Intergenic
1109058179 13:57579934-57579956 TTTATTTGAGGGAATAATCAAGG - Intergenic
1109324898 13:60855343-60855365 TGAACTGAAGAGAACATTCAGGG + Intergenic
1109986833 13:69997301-69997323 TATTTTGGTAAGAATATTCAAGG + Intronic
1110105067 13:71663497-71663519 ATTATTGGAGAAAAGATTCAAGG + Intronic
1110364689 13:74668917-74668939 TGTTTTGAAAAGAATACTCAGGG + Intergenic
1110645311 13:77876906-77876928 GATATTGGAGAGAAAATTCAGGG + Intergenic
1110916101 13:81022622-81022644 TGTATTTGAGAGAATAATTCAGG + Intergenic
1110960744 13:81621753-81621775 TGGATTGCAGAAAATATTTAAGG - Intergenic
1111286033 13:86093006-86093028 TCTATTGGACAGATTAATCAAGG + Intergenic
1116967803 14:51032341-51032363 AGTCTTTGAGAGAATATTCTGGG - Intronic
1117681898 14:58212485-58212507 TTTATTAGAAAAAATATTCATGG + Intronic
1118140057 14:63071188-63071210 TATATTTGAGGGAATAATCAAGG - Intronic
1118172790 14:63405305-63405327 TGTATTGGAGCTGAGATTCAAGG + Intronic
1118697719 14:68400942-68400964 TGTATTGGAGAAAAGGTTCAGGG + Intronic
1119128062 14:72146704-72146726 TGTTTGGGAGACAATATTAAGGG - Intronic
1123807030 15:23885009-23885031 TGTATTGGAGACTCTATCCAGGG - Intergenic
1123885500 15:24723272-24723294 TGTACTGGAGGATATATTCAGGG - Intergenic
1124241202 15:28029081-28029103 TGTATCATATAGAATATTCATGG + Intronic
1125172007 15:36776272-36776294 TGTATTGGAGAGAATATTCAGGG + Intronic
1126150233 15:45517320-45517342 TGGATTGGAGGGTATATTCTTGG - Intronic
1126821509 15:52508835-52508857 TGTATTGTTGAAAATATGCAAGG - Intronic
1128778085 15:70339193-70339215 TGTAAGGGAGGGAATATTTATGG - Intergenic
1129085832 15:73090674-73090696 TGTATTAGAAAGAATACTAATGG + Intronic
1133411454 16:5572645-5572667 TGTAATGGAGAAAATCTGCAGGG + Intergenic
1133953043 16:10414152-10414174 CGTATTTGGGAGAATAGTCAAGG - Intronic
1136393546 16:29980113-29980135 TGTAATGCAGAGAATATTGAAGG + Intronic
1138633832 16:58320631-58320653 TGTTTTGGAGAGGGTGTTCAGGG + Intronic
1146503009 17:33380647-33380669 TGCCTTGGAGAGCATAGTCATGG + Intronic
1146626727 17:34440518-34440540 TGTGAGGGAGAGAATATTCTGGG - Intergenic
1146960931 17:36977966-36977988 GGTATTTGAGAGAGTATTCAGGG + Intronic
1147484501 17:40799536-40799558 TGAATTAGAGAGAAAAATCAAGG - Exonic
1147545502 17:41398219-41398241 TGTAGAGGAGAGAATTTTAAAGG + Intergenic
1148100914 17:45090691-45090713 TGTCATGGAGAGAATTTTGAGGG + Intronic
1148992789 17:51680976-51680998 TATATTGTAGGGAATATTTATGG + Intronic
1149238438 17:54619927-54619949 GGTAATGGAGACAATATCCAGGG + Intergenic
1153264226 18:3253452-3253474 TCTATTGGATAGAATTTCCATGG + Intronic
1153563494 18:6395809-6395831 TTTATTGTAGATAATATCCATGG - Intronic
1157203384 18:45678154-45678176 TGTTTTGGAGGGGAGATTCAAGG - Intronic
1158299886 18:56039610-56039632 TGCATTAAAGAGAAAATTCATGG + Intergenic
1161896420 19:7085052-7085074 AAAAATGGAGAGAATATTCAAGG - Intronic
1163152300 19:15422659-15422681 TGTGTGTGAGAGGATATTCATGG + Exonic
1164251851 19:23484239-23484261 TATATTTGAGGGAATAATCAAGG + Intergenic
1166222976 19:41377368-41377390 TGTTTTGGGGCAAATATTCAAGG + Intronic
1168136572 19:54356004-54356026 TGTCTTGGGGAGAAAATACATGG + Exonic
925191083 2:1884173-1884195 TGTATTGTAGAGAATAATTTTGG + Intronic
926857185 2:17269894-17269916 TGTAAAAGAGAGAATATTCATGG + Intergenic
927370456 2:22348500-22348522 TGTTTTAGAGAGTATATCCATGG - Intergenic
927751891 2:25676727-25676749 TGGATTGGAGAGAATGGGCAAGG - Intergenic
929597101 2:43183020-43183042 TGTTTGGGAGAGAGTAATCACGG + Intergenic
930597621 2:53407340-53407362 TGTATTGGAGAATGTATTCAGGG - Intergenic
931122173 2:59232006-59232028 GGTGTATGAGAGAATATTCATGG - Intergenic
933442318 2:82328594-82328616 TGAATTGGAAACAATATTCTTGG + Intergenic
934177599 2:89590410-89590432 TGTATTTGGGGGAATAATCAAGG - Intergenic
934287898 2:91664711-91664733 TGTATTTGGGGGAATAATCAAGG - Intergenic
937828817 2:126398269-126398291 TATATTTGAGGGAATAATCAAGG - Intergenic
939219483 2:139282835-139282857 TATATTTGAGGGAATAATCAAGG + Intergenic
939264734 2:139856489-139856511 AGTAATTCAGAGAATATTCAAGG + Intergenic
939767096 2:146264304-146264326 TGTATTTGTGAGACTATCCAGGG + Intergenic
940174656 2:150864694-150864716 TGTTTAGGAGAGAAAATTAAGGG - Intergenic
940328317 2:152448888-152448910 TGTATTTCAGAGACTCTTCAAGG - Intronic
940444962 2:153766117-153766139 TTTGTTGGATAAAATATTCATGG + Intergenic
940837048 2:158534024-158534046 TGTTTTGGAGAGAAGAAGCAGGG - Intronic
941872688 2:170402063-170402085 AGTATTTGAGAGAATAGTCTTGG + Intronic
942119050 2:172758644-172758666 TGTATGGGAAAGAAGAGTCAAGG + Intronic
942424990 2:175850075-175850097 TAGAGTGGAGAGAATGTTCAGGG + Intergenic
943454152 2:188082115-188082137 TGTAGTGGAGATAATAGCCATGG - Intergenic
943490690 2:188552091-188552113 TGAATTGGAGAAAATATTTTCGG - Intronic
945780817 2:214169535-214169557 AATATTGGAGAGAATATCAATGG - Intronic
948333615 2:237191115-237191137 AGAATTGGAGCGAATATTCCAGG + Intergenic
1170304305 20:14920737-14920759 TTTATTCCAGAGAAAATTCAAGG - Intronic
1170490890 20:16873270-16873292 AGGACTGGAAAGAATATTCAAGG + Intergenic
1170740118 20:19048725-19048747 TGTATTGGTGAGCATCTTCTTGG - Intergenic
1174375711 20:50125206-50125228 TGAATGGGAGAGAGTAGTCAAGG + Intronic
1174738147 20:52984910-52984932 AGAATTAGAGAAAATATTCATGG - Intronic
1174740408 20:53008043-53008065 TGTATGTGAGTTAATATTCAAGG + Intronic
1177124429 21:17178382-17178404 CATATTTGAGAGAATAATCAAGG + Intergenic
1177681249 21:24374447-24374469 CATATTTGAGAGAATAATCAAGG - Intergenic
1179195677 21:39160389-39160411 TGTACTGGAAAGGAAATTCAAGG - Intergenic
1183816407 22:40305338-40305360 TGTGTTGGTGAGAAATTTCAGGG + Intronic
1184063840 22:42103949-42103971 CTTATTGGAGGGAATAATCAAGG - Intergenic
1184583395 22:45431590-45431612 CGGATTGGAGAAAATATTCCTGG - Intronic
1184789344 22:46689749-46689771 TGTTTTGCAGATAATTTTCATGG - Intronic
1203305347 22_KI270736v1_random:105308-105330 TGCATTGGAGTGAATAGGCATGG + Intergenic
949226668 3:1703086-1703108 TGTATTTGAGATAATATGGAGGG - Intergenic
949749460 3:7334029-7334051 TGTATTTAAGGGAATAATCAAGG + Intronic
950035036 3:9879074-9879096 GGTATTGGAGAGTATGTACAAGG - Intronic
950680034 3:14578874-14578896 TTTATTGGAGAGGAAATTGAGGG - Intergenic
951155326 3:19346117-19346139 TTTATTGTAGTAAATATTCAGGG + Intronic
951538702 3:23762455-23762477 TGTATTGGTGAGAATTCTCTTGG - Intergenic
956223501 3:66930005-66930027 TCTTCTGGAGAGAATATTAAAGG + Intergenic
956329508 3:68090176-68090198 TGTGTTGGAGAGAAGACTCTTGG - Intronic
956540285 3:70329516-70329538 TGTATTATAGAAAAAATTCAGGG + Intergenic
957322655 3:78652617-78652639 TTTAATGCAGAGATTATTCATGG - Intronic
957324321 3:78672957-78672979 TGTATTGGAGAGAGTAGATATGG - Intronic
957482956 3:80822008-80822030 TTTGTTGTACAGAATATTCATGG - Intergenic
958465449 3:94452128-94452150 TGAACTGTAGAAAATATTCAGGG + Intergenic
959877950 3:111408095-111408117 CCTATTTGAGAGAATAATCAAGG + Intronic
959973015 3:112428230-112428252 TGTTCAGGAGAGAATATTAAGGG + Intergenic
960453671 3:117842853-117842875 TGTATGCCAGAGACTATTCAAGG - Intergenic
960548851 3:118950482-118950504 TATTTTATAGAGAATATTCAAGG + Intronic
961161775 3:124732549-124732571 TGTATTGGAAAGCATATTTACGG - Intronic
962010485 3:131386139-131386161 TGACTTGGAGAGTATGTTCAAGG - Intronic
962673006 3:137728021-137728043 TTTATTGGAGATAATTTTCTTGG - Intergenic
963298697 3:143575690-143575712 TGTTTTAAAGAGAATGTTCAGGG + Intronic
963551083 3:146723878-146723900 TGTAATGTTGAGAATATACAAGG + Intergenic
963657419 3:148074762-148074784 TATATTATAGAAAATATTCATGG - Intergenic
964075806 3:152689853-152689875 TGTATTTGAGGGAATAATCAAGG + Intergenic
966212692 3:177469485-177469507 TAGAGTGGAGAGAATATTTAGGG + Intergenic
967564594 3:190959039-190959061 TGAACTGGAGAGAAGATTTAGGG + Intergenic
967659409 3:192087352-192087374 CTTAGTGGAGAGTATATTCAAGG - Intergenic
969185780 4:5473335-5473357 TGCATTGGAGAGAACCCTCAAGG - Intronic
969389659 4:6881951-6881973 TGTGTTTGAGAGAATGTTCTGGG + Exonic
969561348 4:7950305-7950327 TTGATTGGAAACAATATTCAGGG + Intergenic
970330296 4:14975575-14975597 TGTTTTGTATATAATATTCAGGG + Intergenic
971896190 4:32598303-32598325 TGTATTGAAGGGATTATCCATGG - Intergenic
973085379 4:46052924-46052946 AGGATTGGAGAAAATATTAAAGG + Intronic
973920239 4:55676732-55676754 CTTATTTGAGAGAATAATCAAGG + Intergenic
974359397 4:60856859-60856881 TCTTTTGAAGAGAATATCCAAGG - Intergenic
974451482 4:62067815-62067837 TATATTGGTGAAAATAGTCATGG + Intronic
974649598 4:64737712-64737734 TTAATTGGAGTGTATATTCAGGG - Intergenic
975408641 4:74022114-74022136 TGAATGGAAGAAAATATTCAAGG + Intergenic
975498934 4:75063376-75063398 AACTTTGGAGAGAATATTCAGGG + Intergenic
975662797 4:76704511-76704533 TGAATTGGGAAGAATATTCCAGG + Intronic
976456255 4:85250132-85250154 TATTTTGGAGAAAATTTTCAAGG - Intergenic
976794615 4:88918669-88918691 TATATTGGAGTGAAAATACATGG + Intronic
976846381 4:89492837-89492859 TTTATTTGACAGAAAATTCAAGG + Intergenic
977873789 4:102125317-102125339 TGAATTTGGGAGAATATTAATGG - Intergenic
977874630 4:102134396-102134418 TTTATTGGAGATTATATTCTAGG - Intergenic
978794952 4:112699820-112699842 TGTATGAGAGAGAGTAGTCAAGG + Intergenic
979219708 4:118208598-118208620 TTTATTAGAGAGAATATACTAGG - Intronic
979521275 4:121669920-121669942 TGTATTAGATAGAAGGTTCATGG + Intronic
980087647 4:128408431-128408453 ATTATTTGAGAGAATAATCAAGG - Intergenic
980274719 4:130634342-130634364 TGTATTTGAGGGAATAATCCAGG + Intergenic
981025840 4:140076290-140076312 TATATTGGAGAAAATATCTAAGG - Intronic
982264552 4:153526389-153526411 TGTATTGGATAGAGGATGCAGGG + Intronic
982709047 4:158741689-158741711 AGTATTGGAGAGAATGTGCGTGG + Intergenic
982718711 4:158837404-158837426 TGTTGTGGAGAAAAGATTCAGGG + Intronic
982719565 4:158846256-158846278 TATATTACAGAGAATTTTCATGG + Intronic
983129562 4:163999662-163999684 TGTATTGAAGAAAATAATAATGG + Intronic
983890059 4:173021415-173021437 TGTTTTGGAGAGAAGATGCAAGG - Intronic
985184355 4:187299652-187299674 TGAATTGGTGAGAAAACTCAAGG - Intergenic
985248881 4:188003152-188003174 TGTATTCCAAAGAACATTCAAGG - Exonic
985257029 4:188080589-188080611 GGGATTGGAGAGAATGTTCAGGG + Intergenic
987154683 5:15077380-15077402 TGTTTGGGAGAGAATATTAAGGG + Intergenic
987640253 5:20602948-20602970 TATATTTGAGAGATTAATCAAGG + Intergenic
987719194 5:21612966-21612988 TTTATTTGAGTGAATATTGAGGG + Intergenic
988161922 5:27529529-27529551 AGTATTGGACAGATTATTAATGG - Intergenic
988966350 5:36422256-36422278 AGTCTTGTAGAGGATATTCATGG + Intergenic
990630641 5:57665256-57665278 TGGATTGAAGAAAATGTTCACGG + Intergenic
991065600 5:62421237-62421259 TGTATTATACAGAATATACAAGG - Intronic
992981195 5:82174989-82175011 TGGTTTGGAGAGGGTATTCATGG + Intronic
994008942 5:94877255-94877277 TGTATTATAGAGACTATTAAAGG - Intronic
994445334 5:99864853-99864875 TTTGTTAGAGAGAATATTCTAGG + Intergenic
997784820 5:136700501-136700523 TGTCCCAGAGAGAATATTCAAGG - Intergenic
998231042 5:140361512-140361534 TGTTGTGGGGAGAAGATTCAGGG + Intronic
998741774 5:145211260-145211282 CATATTTGAGAGAATAATCAAGG + Intergenic
998827896 5:146123423-146123445 TGGATTGGGTAGAAAATTCAGGG + Intronic
999086241 5:148892972-148892994 CATATTTGAGAGAATAATCAAGG + Intergenic
1000731779 5:164843703-164843725 GGTAGTTGAGAAAATATTCATGG + Intergenic
1000910708 5:167018690-167018712 TATTTTGGAAAAAATATTCAAGG + Intergenic
1000981469 5:167821064-167821086 TCTATTGTAGAGGATCTTCAGGG + Intronic
1001802590 5:174557057-174557079 TGAATTGAATAGAATATTAAAGG - Intergenic
1006327037 6:33362164-33362186 TCTATTTGCCAGAATATTCAGGG + Intergenic
1008231351 6:48987893-48987915 TGTATTTGAGGGAATAATCAAGG + Intergenic
1008775273 6:55030925-55030947 TGTATTTGGGGGAATAATCAAGG - Intergenic
1009551137 6:65093174-65093196 TTTACTGGGGATAATATTCATGG - Intronic
1011225330 6:85098452-85098474 TGTATTTGAGGGAATAATCAAGG + Intergenic
1011914073 6:92480277-92480299 TGTATGGGTGTGAATATACATGG - Intergenic
1012239423 6:96855311-96855333 TGTATGGGAGAGAATTCTAATGG - Intergenic
1013598380 6:111681660-111681682 TGCATTGGAGAGATTAGTGAAGG - Intronic
1013730069 6:113154959-113154981 TGTTTGGGAGAGAATATTAAGGG + Intergenic
1014589863 6:123250849-123250871 TGTCAGGTAGAGAATATTCAAGG - Intronic
1015159755 6:130139542-130139564 AGTGTTGTAGAAAATATTCAAGG - Intronic
1015541277 6:134316700-134316722 TGTATTTGAGTGATAATTCAGGG - Intronic
1015612679 6:135042448-135042470 TGTATTGAAGAGAAAATTTCAGG - Intronic
1015649322 6:135437190-135437212 TTTACTGTAGAGAATGTTCATGG + Intronic
1015899999 6:138054539-138054561 TTTATTTGAGGGAATAATCAAGG + Intergenic
1020450766 7:8318208-8318230 TTAATTGGAGTGTATATTCAGGG - Intergenic
1020549707 7:9587335-9587357 TATTTTGGACAGAATATTTAGGG - Intergenic
1020685993 7:11295866-11295888 AGTATTAAAAAGAATATTCAAGG - Intergenic
1020737222 7:11965792-11965814 TTAATTGGAGTGTATATTCAGGG - Intergenic
1020957237 7:14755664-14755686 TGTATTGAAGAGAACTTTAAGGG + Intronic
1021103693 7:16613276-16613298 TGTATTGGGGAGAATTTCCGAGG + Intronic
1023328722 7:39089799-39089821 TATATGGGAGAAAATATTTAGGG - Intronic
1024876080 7:54025429-54025451 TATATTTGAGGGAATAATCAAGG - Intergenic
1027563047 7:79756680-79756702 CGTATTTGAGGGAATAATCAAGG - Intergenic
1027563569 7:79762667-79762689 TGTCTTCAAGAGAATTTTCATGG + Intergenic
1028197274 7:87921516-87921538 TTTATTTGAGGGAATAATCAGGG + Intergenic
1028250799 7:88538372-88538394 TATATTTGAGGGAATAATCAAGG - Intergenic
1029390008 7:100268759-100268781 TGGATGGGGGAGAATATTCCAGG + Intronic
1030254194 7:107489191-107489213 TGTATTTTAGAGAACATTTAAGG - Intronic
1030341495 7:108385782-108385804 TGTATTGGAGAGAATATGGAAGG + Intronic
1030481430 7:110109638-110109660 TGTATGGTATAGACTATTCAGGG - Intergenic
1030817124 7:114052062-114052084 TGTTTTGAAGAGAACATTAAGGG + Intronic
1030979482 7:116169460-116169482 TGAAAGGGAGAGGATATTCAAGG - Intergenic
1031374506 7:121007701-121007723 AGTATTGGAGAGAAAATTTCAGG - Intronic
1033469944 7:141637469-141637491 TGTATTGGAGAGTATAGATATGG + Intronic
1033489371 7:141826659-141826681 TGCATTGGATAGAATTTTCAGGG + Intergenic
1033832665 7:145272318-145272340 TACATTGGTGAGAATCTTCAGGG + Intergenic
1038912421 8:31981268-31981290 TGTATTTGAAAGTATATTCTTGG + Intronic
1039164589 8:34663418-34663440 TTAATTGGAGTGAAAATTCAGGG - Intergenic
1039249070 8:35641950-35641972 AGTGTTTGAGAGAATTTTCAGGG - Intronic
1041478348 8:58290636-58290658 TGTAATTAAGAGACTATTCATGG + Intergenic
1041923562 8:63211765-63211787 TGTAATTGAGAGTCTATTCATGG + Intronic
1042084335 8:65090972-65090994 CTTATTTGAGAGAATAATCAAGG + Intergenic
1044033115 8:87262893-87262915 TGTATTGGAGATAATGATGATGG + Intronic
1046253946 8:111671973-111671995 TGAATTGGAGAAAATAATAATGG + Intergenic
1046256446 8:111703284-111703306 TGTTTTGAAGAGAAGATACATGG + Intergenic
1046575976 8:116029488-116029510 TGTATTGGAAAGAGTTTCCATGG + Intergenic
1047227184 8:122966724-122966746 TTTATTTGAGGGAATAATCAAGG - Intronic
1047801005 8:128310025-128310047 TGCCTTGGAAAGAATAATCATGG - Intergenic
1048556287 8:135480268-135480290 TGTCTTGGAGAGTCTAGTCAGGG + Intronic
1050038946 9:1467105-1467127 TTTAATGCATAGAATATTCACGG + Intergenic
1050162701 9:2734586-2734608 GGTCTTGGAGAGAATGTTCTGGG + Intronic
1052307331 9:27025087-27025109 TGTATTTGAGGGAATAATCAAGG + Intronic
1052565747 9:30148451-30148473 ATTATTAGAGATAATATTCATGG + Intergenic
1055181999 9:73400345-73400367 TTTATTTGTGAGAATAATCAAGG - Intergenic
1055613336 9:78045232-78045254 TGTAAAGGGGAGAAAATTCAAGG + Intergenic
1056068244 9:82959111-82959133 AGGATTGGAGAGAATCTCCAAGG + Intergenic
1056396739 9:86188129-86188151 CGTATTTGAGGGAATAATCAAGG + Intergenic
1057818040 9:98310141-98310163 GATATAGGAGAGAAGATTCAAGG + Intronic
1058568607 9:106314733-106314755 TATAATGGAGAGAACACTCATGG + Intergenic
1061379669 9:130246812-130246834 TGTTTTGGAAGGAACATTCATGG - Intergenic
1186207862 X:7218840-7218862 TGAAAGGGAGAAAATATTCAAGG + Intergenic
1187787966 X:22914762-22914784 TGAATTGGACAAAACATTCAGGG - Intergenic
1188138074 X:26514464-26514486 TCTAGTGGAGAGAAGATTCCAGG + Intergenic
1189675647 X:43458020-43458042 AGGATTGGAGAGAATATTGAAGG - Intergenic
1190229834 X:48573806-48573828 TCTATTGGTGAGAAAATTAAGGG + Intergenic
1192009844 X:67257192-67257214 AATATTGGAGAAAATCTTCAGGG + Intergenic
1193157047 X:78184720-78184742 CGTATTTGGGAGAATAATCAAGG + Intergenic
1194167583 X:90538890-90538912 TCTGTTGGAGAAAAAATTCATGG - Intergenic
1194696528 X:97058842-97058864 TGTAGGGAAGAGAACATTCACGG - Intronic
1195454732 X:105054938-105054960 AATTTTGGAGATAATATTCAAGG - Intronic
1195529563 X:105937820-105937842 TGCACTGGAGAGAACATGCAAGG - Intronic
1195567150 X:106354259-106354281 TGTATTTGTGAGCATATGCATGG + Intergenic
1196519245 X:116653829-116653851 TGTAATTGAGGGAATAATCAAGG - Intergenic
1197058335 X:122147559-122147581 TGTTCTGGAAAGAATATTAAGGG + Intergenic
1197679680 X:129368898-129368920 TGTATAGCAGAGAAAATTCATGG - Intergenic
1198798088 X:140420948-140420970 TGCATTGCAGAGAATATATAGGG - Intergenic
1200513840 Y:4116672-4116694 TCTGTTGGAGAAAAAATTCATGG - Intergenic
1201647089 Y:16246798-16246820 TATATTGGAGTGAAAATTCCAGG + Intergenic
1201655722 Y:16338504-16338526 TATATTGGAGTGAAAATTCCAGG - Intergenic