ID: 1125172191

View in Genome Browser
Species Human (GRCh38)
Location 15:36778212-36778234
Sequence CTGTGGGGGTCAGTAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125172191_1125172198 -5 Left 1125172191 15:36778212-36778234 CCTGAAGCTACTGACCCCCACAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1125172198 15:36778230-36778252 CACAGATGCCTCAGATTGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 181
1125172191_1125172195 -8 Left 1125172191 15:36778212-36778234 CCTGAAGCTACTGACCCCCACAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1125172195 15:36778227-36778249 CCCCACAGATGCCTCAGATTGGG 0: 1
1: 0
2: 1
3: 11
4: 143
1125172191_1125172202 27 Left 1125172191 15:36778212-36778234 CCTGAAGCTACTGACCCCCACAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1125172202 15:36778262-36778284 AGGAAAGGATGAGAGTGACATGG 0: 1
1: 0
2: 2
3: 81
4: 686
1125172191_1125172201 12 Left 1125172191 15:36778212-36778234 CCTGAAGCTACTGACCCCCACAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1125172201 15:36778247-36778269 GGGAGGACACACGTCAGGAAAGG 0: 1
1: 0
2: 0
3: 18
4: 155
1125172191_1125172203 28 Left 1125172191 15:36778212-36778234 CCTGAAGCTACTGACCCCCACAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1125172203 15:36778263-36778285 GGAAAGGATGAGAGTGACATGGG 0: 1
1: 0
2: 2
3: 35
4: 370
1125172191_1125172200 7 Left 1125172191 15:36778212-36778234 CCTGAAGCTACTGACCCCCACAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1125172200 15:36778242-36778264 AGATTGGGAGGACACACGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1125172191_1125172193 -9 Left 1125172191 15:36778212-36778234 CCTGAAGCTACTGACCCCCACAG 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1125172193 15:36778226-36778248 CCCCCACAGATGCCTCAGATTGG 0: 1
1: 0
2: 1
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125172191 Original CRISPR CTGTGGGGGTCAGTAGCTTC AGG (reversed) Intronic
900168776 1:1255939-1255961 CTGGGGAGGTCTGCAGCTTCAGG + Intronic
903953371 1:27009467-27009489 CTCTGGGCTTCAGTAGCTTGAGG - Intronic
904366439 1:30013760-30013782 CTGTGGGAGTCAGAGGCTTAGGG + Intergenic
904947157 1:34207916-34207938 GTGTGGGAGACAGGAGCTTCAGG - Intronic
906788577 1:48638274-48638296 CTGTGGGGACCAGCAGCTTTGGG + Intronic
907999302 1:59665183-59665205 CTGGGGAGGTCAGTAGGTTTTGG + Intronic
908554893 1:65248098-65248120 TTGTGGGAGTCAGAGGCTTCTGG + Intergenic
913479866 1:119277786-119277808 CTGTGGGGGTCAGCATGGTCTGG - Intergenic
915446265 1:155976589-155976611 CTGTGGGGGCAGGTAGCTACTGG - Intronic
915873490 1:159587476-159587498 CTGTGTGGCTCAGGAGCTTCTGG + Intergenic
916649103 1:166818454-166818476 CTGTGGGGCTCAGTGTCTACTGG - Intergenic
917120496 1:171641137-171641159 GTGTGGGGGCCAGTAGTATCTGG + Intronic
919900722 1:202042523-202042545 CTAGGGTGGTCAGTAGCTTTAGG + Intergenic
920229641 1:204461859-204461881 CTGAGGGGGTGAGTGGGTTCAGG - Intronic
920848144 1:209610673-209610695 CTGCAGGGGTCAGGGGCTTCAGG - Intronic
921553178 1:216564302-216564324 CTGTCGGGGACAGTAGGGTCAGG + Exonic
922459316 1:225802832-225802854 CTCTGGGTGTCAGTGGCCTCAGG + Intergenic
922480622 1:225938103-225938125 CTCTGGGTGTCAGTGGCCTCAGG - Intronic
923013019 1:230104159-230104181 CTGCAAGGGTCAGTAGGTTCTGG + Intronic
1063644439 10:7865126-7865148 GCCTGGGGGTCAGGAGCTTCAGG + Intronic
1065636747 10:27742605-27742627 CTGGGGGGGGCGGTAGCTTGCGG - Intronic
1067405137 10:46015636-46015658 CTGAGGGGGTCAGTATTTCCTGG - Intronic
1067770036 10:49116113-49116135 CGGCGGGGTTCAGTAGCATCTGG - Intergenic
1069695998 10:70385923-70385945 CAGTGGGGGTCAGACCCTTCAGG - Intergenic
1070967351 10:80537723-80537745 CTGAGGGGCCCAGCAGCTTCTGG + Intergenic
1075066039 10:119289479-119289501 CTGTGGGGGTCAGAAGATGGTGG + Intronic
1076785786 10:132749258-132749280 CTGTGGGCGGCAGCAGCTCCGGG + Intronic
1077113308 11:871529-871551 CTGTGGAGACCAGAAGCTTCTGG - Intronic
1078093822 11:8284169-8284191 CTGTGGGTGGCTGTGGCTTCAGG - Intergenic
1081759852 11:45569647-45569669 CTGTGGGAGACAGAAGCTCCAGG + Intergenic
1081763796 11:45595212-45595234 CTGATGTGGTCAGTAGTTTCTGG + Intergenic
1083022813 11:59524608-59524630 GTGTGTGGTTCAGTAACTTCAGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084004158 11:66314471-66314493 CAGTGGGGGTCAGAAGCCTTGGG + Exonic
1087394153 11:97575179-97575201 CTGGGGGTGGCAGTAGCTTGTGG - Intergenic
1088991064 11:114954067-114954089 CTGAGGGGGTCAGTAGTATAGGG - Intergenic
1090938268 11:131364635-131364657 CAGTGTGAGTCAGTACCTTCAGG - Intergenic
1091205071 11:133815121-133815143 GTGTGGGGGTCAGGAGGGTCTGG + Intergenic
1091326186 11:134689992-134690014 CTGAGGGGGTAAATGGCTTCAGG - Intergenic
1092943145 12:13429074-13429096 CTTTGTGGGTCTGCAGCTTCTGG - Intergenic
1092994853 12:13940212-13940234 CTGTGGGTGTAAGTGGCATCAGG - Intronic
1094840042 12:34339028-34339050 CTGTGGGGCCCAGCAGCTCCGGG - Intergenic
1098576614 12:72049985-72050007 CTGTGGGGGTCAGTCATTCCAGG - Intronic
1100344503 12:93714582-93714604 CTCTGGAGGTCAGCTGCTTCTGG + Intronic
1103337331 12:120199542-120199564 TTGTGGGGTTCAGTTTCTTCTGG - Intronic
1104669903 12:130673477-130673499 CTCTGGAGGTCAGTAGCTGGTGG - Intronic
1105617389 13:22030939-22030961 CTGTGCTGGTCAGTAATTTCTGG + Intergenic
1108174650 13:47779619-47779641 CTGTGGTGGTCGTTAGGTTCAGG + Intergenic
1110850689 13:80241413-80241435 CTTTGGGGCTCTGTAGCTCCTGG - Intergenic
1113514299 13:110880324-110880346 ATGTGTGTGTCAGTAGCATCAGG + Intronic
1113892403 13:113743337-113743359 CAGTGGGGGCCAGTAGAATCTGG + Intergenic
1114864004 14:26565016-26565038 CTGTGTGGGAAAGTAGCTACAGG + Intronic
1116111652 14:40592539-40592561 CTGTGGGTTTCTGAAGCTTCAGG + Intergenic
1117477183 14:56107759-56107781 CTGTGGGGGTCAGTTCCATCTGG + Intergenic
1121016857 14:90554213-90554235 CTTTGGGGCTCAGAAGCTGCTGG - Intronic
1123072532 14:105648758-105648780 CAGTGGGGGTCAGAAGCTTCAGG - Intergenic
1125039154 15:35163115-35163137 CTGTGGGGGTCAGAAGATGATGG - Intergenic
1125172191 15:36778212-36778234 CTGTGGGGGTCAGTAGCTTCAGG - Intronic
1128791755 15:70439403-70439425 GTGTGGTGTTCAGTAGCTTGTGG - Intergenic
1133220737 16:4318128-4318150 CTTTTGGGGTCAGTGGCTTCTGG + Intronic
1137411956 16:48236143-48236165 CTGTTAGTTTCAGTAGCTTCAGG + Intronic
1138527055 16:57614911-57614933 CTCTGTGAGTCAGTAGCATCAGG - Intronic
1139266716 16:65646664-65646686 CTGTGGGGATAAGTAGATTTGGG - Intergenic
1139349389 16:66325738-66325760 CTGTGGGGGGAAGTAGATGCTGG - Intergenic
1139704965 16:68734929-68734951 CTCTGGGGGTCAGAAGATCCTGG + Intergenic
1139913240 16:70411597-70411619 GTGTGGAGGTCAGTAGTTCCAGG - Intronic
1140455006 16:75099907-75099929 CTGTGGGAGTTAGTGGCCTCCGG - Intronic
1140926615 16:79589973-79589995 CTGAGGGACTCGGTAGCTTCAGG + Intronic
1142026811 16:87818797-87818819 CTCTGGGGGACGGCAGCTTCTGG + Intergenic
1142127291 16:88416531-88416553 CTCTCTGGGTCAGAAGCTTCCGG - Intergenic
1142521372 17:507239-507261 CTGTGGGGGGGAGTGGCATCAGG + Intergenic
1144783527 17:17819597-17819619 CTGTGACTGTCAGTAGCTGCTGG + Exonic
1145790811 17:27625509-27625531 CTTTGGGGCCCAGTGGCTTCTGG - Exonic
1146398850 17:32488115-32488137 CCGTGGGGGACAGGTGCTTCAGG - Exonic
1148890485 17:50803474-50803496 CTGTGGGCTTCAGCAGCTCCAGG + Intergenic
1154085634 18:11302968-11302990 CTGTGGAGGCCAGTGCCTTCCGG - Intergenic
1154397107 18:14000956-14000978 CTGTGCGAGTCAGTATATTCTGG + Intergenic
1156282837 18:35657748-35657770 CTGTGGAAGTCAGTGGATTCTGG + Intronic
1157541755 18:48515713-48515735 CTTTGGGGAGCAGTGGCTTCAGG - Intergenic
1157923130 18:51734120-51734142 CGTTGGAGGTCAGTAACTTCAGG + Intergenic
1157991024 18:52496577-52496599 CTTTGGGTCTCAGTAGCTCCTGG + Intronic
1160513042 18:79463197-79463219 CTGTGAGTGCCAGGAGCTTCAGG - Intronic
1161784800 19:6317579-6317601 CTGGTTGGGTCAGTATCTTCAGG - Intronic
1163786151 19:19275911-19275933 CTGTGGGGGCAGGTGGCTTCTGG - Intergenic
1166590938 19:43997937-43997959 CAGTGGGCTTCAGTAGGTTCAGG + Intronic
1167089980 19:47337220-47337242 CTGTGGGTGTCAGTTGCAGCTGG - Intronic
1167357447 19:49012513-49012535 CTGTGGGAGGCAGCAGCTACGGG + Intronic
1168263564 19:55209070-55209092 CTGCGGGGGACACTGGCTTCAGG - Intronic
925845341 2:8028714-8028736 GTCTGGGGTTCAGTGGCTTCTGG - Intergenic
929460382 2:42098906-42098928 CTGTGGGACTCAGGAGCGTCAGG - Intergenic
932237633 2:70133769-70133791 CTGTGGTGTTCATTATCTTCTGG - Intergenic
937022795 2:118673548-118673570 TTGTAAGGGTCAGTAGCGTCTGG - Intergenic
938373437 2:130788437-130788459 CGGTGGGGGGCACTAGTTTCAGG + Intergenic
938910947 2:135885621-135885643 CTGTGGGGATCAATAGCTAGTGG + Intergenic
941189079 2:162354285-162354307 CTCTGGGTGTCAGTATCTTTAGG + Intronic
942042811 2:172082121-172082143 GGGTGGGGGGCAGTAGCATCAGG - Exonic
942683200 2:178501226-178501248 CTGTGGGGCTCTGTAATTTCTGG + Intronic
947864617 2:233387773-233387795 CTCTGGGGCTCAGAAGCTCCAGG - Intronic
948597971 2:239092572-239092594 CCCTGGGGTTCAGAAGCTTCTGG + Intronic
1169990413 20:11497081-11497103 TTGTGGGGGTCTGTAGCCTCTGG - Intergenic
1173866711 20:46317096-46317118 CTGTGGGTGTCGGCAGCTTTTGG + Intergenic
1175139177 20:56847107-56847129 CTGTGTGTGTCACTAGCCTCAGG - Intergenic
1175928914 20:62484462-62484484 GTGTTGGGGGCAGCAGCTTCAGG - Intergenic
1180140370 21:45889827-45889849 CTGGGGGGATCAGAAGCTGCAGG - Intronic
1180708715 22:17825416-17825438 CTGAGCGGGTCAGTGGCTCCTGG - Intronic
1181098554 22:20522956-20522978 CTGTTTTGGTCAGTACCTTCAGG + Intronic
1182288423 22:29261051-29261073 CTGTTTGGCTGAGTAGCTTCAGG - Intronic
1183620943 22:38972193-38972215 TTGTGGGGGTGAGTTGCCTCAGG + Intronic
1184287922 22:43482457-43482479 CTGTGGGAGCCAGTGGCCTCAGG + Intronic
1184974556 22:48051905-48051927 CTGTGGGGTTCAGTAGACCCTGG + Intergenic
952777692 3:37061796-37061818 CTGTGGGAGTGAGTAGCTGAGGG - Intronic
953407209 3:42665361-42665383 CTGTGAGGCACAGCAGCTTCTGG - Exonic
959705879 3:109338354-109338376 CTTTGGGAGTCAGTAGGTTAGGG - Intergenic
959945091 3:112117606-112117628 CTGTGGGACTCAGTGTCTTCAGG + Exonic
962258126 3:133886045-133886067 CTGGGGGAGTCAGTAGGGTCAGG - Intronic
963438084 3:145297890-145297912 CTGTGGAGTTCACTAGCTTGTGG - Intergenic
964424355 3:156535514-156535536 CTGTGGAGCTTAGTAGCTGCCGG - Intronic
966883094 3:184360857-184360879 CTCTGGGGGACAGGAGCTTTAGG - Intronic
966920849 3:184610526-184610548 CTGTGGGCCTCAGTAGCCTTGGG - Intronic
969276223 4:6137609-6137631 CTGTGGGGGTCATTGCCTCCAGG - Intronic
970186143 4:13455528-13455550 TTCTGGGGGTCAGTAGCATTTGG - Intronic
970710677 4:18858753-18858775 CTGTGGGAGTCAGTAGGTTGGGG - Intergenic
974295638 4:59995134-59995156 CTGTGTGTGCCAGCAGCTTCTGG - Intergenic
977433885 4:96968408-96968430 CTGTGTGAGGCAGTAGCCTCTGG + Intergenic
979715893 4:123837326-123837348 CTGTGGTGTTCAGTGGCTTTTGG + Intergenic
980768893 4:137345932-137345954 CTGTTGGGTTCACTTGCTTCAGG + Intergenic
983053009 4:163070510-163070532 CTGTGGGGGTGACTTCCTTCCGG - Intergenic
988460775 5:31435552-31435574 CTGTGGAGTTCATTAGCTGCTGG + Intronic
988554131 5:32221757-32221779 CTTCTGGTGTCAGTAGCTTCTGG + Intergenic
993488193 5:88512981-88513003 CTTTGGAAGTCAGTAGCTACTGG + Intergenic
1000791339 5:165611412-165611434 GAGTGAGTGTCAGTAGCTTCTGG + Intergenic
1001586423 5:172836016-172836038 CTGTGTGATTCAGTAGGTTCCGG + Intronic
1002535617 5:179873966-179873988 CTGTGGGCCTAAGTAGCTTTTGG - Intronic
1003540573 6:7014748-7014770 CTTTGGGGGTCAGTATCTCGGGG + Intergenic
1005992691 6:30913380-30913402 CACTGAGGGTGAGTAGCTTCTGG + Exonic
1011495519 6:87933551-87933573 CTGTGGGGCTCAGAAGATTCAGG - Intergenic
1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG + Intergenic
1018907235 6:168082685-168082707 AAGAGGGGGTCAGTAGATTCGGG - Intergenic
1019819162 7:3227956-3227978 CTATGGGGAGCAGAAGCTTCTGG - Intergenic
1036162859 8:6406043-6406065 CTGTGGGGGTCTGAAGCCTCGGG + Intergenic
1037817645 8:22120443-22120465 CTGTGGGGGACAGAAGCTCTTGG - Exonic
1040779531 8:51091668-51091690 GTGTGAGGGTGAGAAGCTTCTGG + Intergenic
1041019575 8:53625110-53625132 CTGTGGGTTGAAGTAGCTTCAGG + Intergenic
1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG + Intergenic
1049487290 8:142873166-142873188 CAGTGGTGGTCAGTAGATCCAGG - Intronic
1049773649 8:144395024-144395046 CTGTGGGGGCCAGGGGCCTCAGG + Intronic
1049820811 8:144632081-144632103 CTTTGGAGGTCAGAAGCTCCAGG - Intergenic
1049832995 8:144713965-144713987 TTCTGGGGGTCAGGCGCTTCCGG - Intergenic
1055029499 9:71759372-71759394 CTGTGGGGGTCATAGGCTTTTGG + Intronic
1058874469 9:109231600-109231622 CTTTGGGGTTCAGTAGTTCCTGG + Intronic
1060197136 9:121631136-121631158 CTTTGGGGGACAGCAGCTCCTGG + Intronic
1061723787 9:132570343-132570365 CTGAGGGGCTCAGTAGCTTTTGG + Intronic
1061798586 9:133102419-133102441 CCTTGGGGCTCAGAAGCTTCAGG - Intronic
1062573742 9:137197065-137197087 CTGTGGGGGTCATTTGCGGCTGG - Intronic
1189004852 X:36985084-36985106 ATGTGGAGGTAAGTTGCTTCTGG - Intergenic
1189044178 X:37572860-37572882 ATGTGGAGGTAAGTTGCTTCTGG + Intronic
1192178818 X:68902739-68902761 CTGTGGGGTTCTGTAGATTTAGG - Intergenic
1196184567 X:112732253-112732275 CTTTGAGAGTCAGTAACTTCTGG + Intergenic
1197415428 X:126166708-126166730 GTGTGGGGTTCAGCAGCGTCAGG + Intergenic