ID: 1125172606

View in Genome Browser
Species Human (GRCh38)
Location 15:36783097-36783119
Sequence AACTGTATGCAGCTGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125172606_1125172607 6 Left 1125172606 15:36783097-36783119 CCTGTCAGCAGCTGCATACAGTT 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1125172607 15:36783126-36783148 TTTAAGACTCTGTAAAGCTATGG 0: 1
1: 0
2: 0
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125172606 Original CRISPR AACTGTATGCAGCTGCTGAC AGG (reversed) Intronic
901735362 1:11309010-11309032 AATTGTCTGCAGGTGCTGCCTGG + Intergenic
903522969 1:23967799-23967821 AACTGGATGTAGCAGCTTACTGG + Intronic
904965880 1:34372231-34372253 CCCTGTATGCAGCTGCTCACAGG - Intergenic
905266010 1:36754939-36754961 AGCTCCAAGCAGCTGCTGACAGG - Intergenic
905395186 1:37662248-37662270 AACAGATTCCAGCTGCTGACAGG + Intergenic
908108773 1:60874287-60874309 AACAGAATGCATCTGCTGCCTGG + Intronic
909132370 1:71753964-71753986 AGGTGTCTGCTGCTGCTGACTGG - Intronic
910719612 1:90271761-90271783 AACTGAATCAAGCTGCTGTCAGG + Intergenic
1062986744 10:1776220-1776242 AATTGGTTGCAGCTGCTGCCAGG + Intergenic
1068671079 10:59724263-59724285 AACAGTCTGCAGCTGCCTACTGG + Intronic
1069884231 10:71613477-71613499 CACTGTCTGCAGCTTCTGCCTGG + Intronic
1070032425 10:72690467-72690489 TACTGTGTGCAGCTGTTGAATGG + Intergenic
1071140227 10:82501108-82501130 AACTATATGGAGCTGGTGAGAGG + Intronic
1071480868 10:86063870-86063892 AACTGTCTGTAGCTACTGTCAGG + Intronic
1071503747 10:86220929-86220951 AAGTGGATACAGGTGCTGACTGG + Intronic
1073548712 10:104377031-104377053 GACTGTAGGCAGCTGCTTAGAGG - Intronic
1075166518 10:120072636-120072658 AAATGAAACCAGCTGCTGACAGG - Intergenic
1077231294 11:1459200-1459222 AACTGTATGGAAATGATGACGGG + Exonic
1078713341 11:13816247-13816269 ACATGTTTGCACCTGCTGACTGG - Intergenic
1078879110 11:15430500-15430522 AACTTTATGCAGATGCAGCCCGG - Intergenic
1079454651 11:20625956-20625978 ATCTTTATGCAGCTGATGCCTGG + Intronic
1083065788 11:59922650-59922672 CACAGTATGCAGCTGCTGCCTGG - Intergenic
1084364421 11:68688249-68688271 TTCTGTTTGCAGCTGCTGACAGG - Intronic
1085049807 11:73374541-73374563 TACTCTATGGAGCTGCTGCCAGG + Intergenic
1085476591 11:76793157-76793179 AACTGTCTGCAGATGCTCCCAGG - Intronic
1088080747 11:105909319-105909341 AAATGTATGCATTTGCTCACTGG - Intronic
1090370806 11:126250672-126250694 AACTGTATGCAGCAGATCAGGGG + Exonic
1097822965 12:64146125-64146147 AACTGTTTGAACCTGCTGAGTGG + Exonic
1100020945 12:90069039-90069061 AAGTCTAATCAGCTGCTGACTGG - Intergenic
1105485728 13:20829593-20829615 AACTGTCTGCAGCTCTTGAAGGG - Intronic
1107973009 13:45662277-45662299 AACAGGAACCAGCTGCTGACTGG + Intergenic
1113566675 13:111323421-111323443 ATCTTTAGGCAGCAGCTGACAGG - Intronic
1113674789 13:112199661-112199683 TGCTGTCTGCAGCTGGTGACTGG + Intergenic
1116774621 14:49165862-49165884 AACTCTAGGCAGCTGCTTATAGG - Intergenic
1118298771 14:64595368-64595390 AACTTTATGAACCTGCTGCCAGG - Intergenic
1119587756 14:75852843-75852865 AACTGTCAGTAACTGCTGACTGG - Intronic
1121896769 14:97655974-97655996 ACCTTTCTGCAGCTGCTGTCAGG - Intergenic
1123976690 15:25560294-25560316 TGCAGTATGCAGCTGCTGAACGG - Intergenic
1125172606 15:36783097-36783119 AACTGTATGCAGCTGCTGACAGG - Intronic
1127001540 15:54513940-54513962 ATCTCTATGCAAATGCTGACTGG - Intronic
1127666563 15:61153470-61153492 CACTGGATGCAGCTGTTGAAAGG - Intronic
1134200606 16:12195458-12195480 AAATGTAAGCAGTTGGTGACAGG - Intronic
1135916887 16:26613318-26613340 AAATGAATGAATCTGCTGACTGG + Intergenic
1137237376 16:46626654-46626676 AACATTGTGCAGCTGCTGATCGG - Intergenic
1137624561 16:49899693-49899715 ATCTGTAAGCAGCAGCTTACAGG - Intergenic
1139490649 16:67284296-67284318 AAGTTTCTGCAGCCGCTGACTGG + Exonic
1141397636 16:83718995-83719017 AAAGGAATGCAGGTGCTGACAGG + Intronic
1150006425 17:61472037-61472059 AATTCTATGCAGCTGCAGGCCGG - Intronic
1153092773 18:1367230-1367252 AACTTTATGCAGCAGTTGACTGG + Intergenic
1153256777 18:3179625-3179647 AGCTGTCTGAAGCTGCTGGCAGG - Intronic
1153788166 18:8553458-8553480 AATTGGTTGCAGCTGCTGCCAGG - Intergenic
1155381185 18:25224400-25224422 AACTGTGTGCTGTTGCTGTCTGG + Exonic
1167423652 19:49418199-49418221 ACCAGTGTGCAGCTGCTGAGTGG + Intergenic
935070453 2:99689281-99689303 AGCTGACTGCAGCTGCTGCCTGG + Intronic
936607768 2:113975208-113975230 AACTGAATGCTGCGGCTGGCCGG + Intergenic
937137235 2:119564104-119564126 GACTGTAAGCTGCTGATGACCGG + Intronic
940023015 2:149175932-149175954 AACTGTATACAGCCTCAGACAGG - Intronic
940903920 2:159151629-159151651 AACTGGATGAACCTGCTGCCTGG - Intronic
941950239 2:171148183-171148205 TACAGTATGCAGCTGCTGCTGGG - Intronic
942427159 2:175872135-175872157 AGTTGTCTGAAGCTGCTGACAGG - Intergenic
943541370 2:189218722-189218744 AATTGTACACAGCTGATGACTGG - Intergenic
948004212 2:234593927-234593949 AACTCTCTGCAGCTGCAGTCAGG - Intergenic
948308230 2:236965833-236965855 TACTGTATGCAGATCCTCACTGG - Intergenic
1171250808 20:23645529-23645551 AGCTGTAGGCAGCATCTGACGGG + Intergenic
1172762171 20:37330554-37330576 CGCTCTATGCAGCTGCTGGCAGG + Intergenic
1176256645 20:64156507-64156529 AACTGGAAGCAGCTGCAGAGGGG - Intronic
1180189985 21:46158305-46158327 AAATGCATGCAGCTCCTGCCGGG - Intergenic
1180905193 22:19405579-19405601 GACTGAATGCAGCTGGAGACAGG + Intronic
1181280246 22:21714531-21714553 CACTGCATGCAGCCACTGACGGG + Intronic
1182247856 22:28974387-28974409 ATGTATATGCATCTGCTGACAGG - Intronic
1184548793 22:45192763-45192785 AAGTGGAGGCAGCTGCTGATGGG - Intronic
951524738 3:23643182-23643204 GACTCTAAGCAGCTGCTGGCTGG + Intergenic
953020318 3:39108898-39108920 AACTGCATGGAGCTGCTCCCAGG + Intronic
953504745 3:43473992-43474014 AACTGTATACACATGCTGGCTGG - Intronic
956953524 3:74310556-74310578 AACCCTATGCAGCTGTGGACAGG - Intronic
958707815 3:97678038-97678060 AACTGTATTCAGTTCCTGAAGGG + Intronic
959079349 3:101783613-101783635 AGCTGTGTGCTGCTGCTGCCTGG + Intronic
960442094 3:117701562-117701584 ATCTGTATGCATCAGGTGACAGG + Intergenic
961751022 3:129094985-129095007 AACATTGTGCAGCTGCTGATCGG - Exonic
966101623 3:176275879-176275901 AACTGTATACATCTGGTAACTGG + Intergenic
970617868 4:17784482-17784504 AACTGTATACAGCTAGTGAATGG + Intergenic
971315994 4:25568618-25568640 AACTGTCTTAAGATGCTGACTGG - Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
978545987 4:109873182-109873204 AACTGTGTCCAGGTGGTGACTGG - Intergenic
978633972 4:110781413-110781435 AACTGTCTGCAGGTATTGACAGG + Intergenic
978852277 4:113353570-113353592 AACTGTCTGCAGCTGCTCTTTGG - Exonic
980156475 4:129114078-129114100 CACTGTATGCAACTGATGGCTGG - Exonic
984223731 4:177008990-177009012 AATGGTATGCAGCTGCAGTCAGG - Intergenic
984340816 4:178453879-178453901 AGCGGGTTGCAGCTGCTGACAGG + Intergenic
986443025 5:7797956-7797978 CACTGAATGCAGGTGCTGATGGG + Intronic
986636470 5:9827061-9827083 ATCTATATGCAACTGCTGACAGG + Intergenic
986729735 5:10626321-10626343 AAGTGTATGCAGCTGCCAAGTGG + Intronic
987298393 5:16574626-16574648 AACAGTCTGCAACTGCTGCCAGG + Intronic
990936847 5:61160565-61160587 AACTGTATTCAGCTGTTTCCTGG - Intronic
997203238 5:132025599-132025621 AGCTGGAAGGAGCTGCTGACAGG - Intergenic
997430595 5:133837792-133837814 ACGTGAATGCAGCTGCTGAGAGG - Intergenic
1001621269 5:173087399-173087421 AAAAGTATGCAGCTGTTGGCTGG + Intronic
1003492563 6:6636429-6636451 AACTTTGTGCAGCTGATGACAGG + Intronic
1011672439 6:89695873-89695895 AACTGTGAGCAGCTGCTGCTTGG - Exonic
1018662802 6:166103986-166104008 AACTCTATGGAGCTGGTGAAAGG - Intergenic
1018723019 6:166588293-166588315 GAGTGTGTGCAGCTGCTCACAGG + Intronic
1020720661 7:11740547-11740569 ACCTGTGTCCAGCTGCTGAGGGG - Intronic
1023259063 7:38340513-38340535 AACAGGGTACAGCTGCTGACAGG + Intergenic
1023259534 7:38344841-38344863 AACAGGGTGCAGCTGCTGCCAGG + Intergenic
1023260469 7:38353526-38353548 AACAGGGTGCAGCTGCTGCCAGG + Intergenic
1023260978 7:38358323-38358345 AACAGGATGCAGCTGCTGCCAGG + Intergenic
1023261443 7:38362675-38362697 AACAGGGTGCAGCTGCTGCCAGG + Intergenic
1023261946 7:38367412-38367434 AACAGGGTGCAGCTGCTGCCAGG + Intergenic
1024573095 7:50741427-50741449 GCCTGCATGCAGCTGCAGACAGG + Intronic
1025024207 7:55503130-55503152 CACTCTGAGCAGCTGCTGACAGG + Intronic
1032096394 7:128940387-128940409 AATTGTGTGCCGCTGGTGACTGG + Intronic
1034846563 7:154451566-154451588 AACTGAATGTAGATGCTGGCAGG - Intronic
1035081927 7:156223443-156223465 AACTGTAGCCAGCTACTCACAGG + Intergenic
1038996992 8:32934593-32934615 AACTGTATCCAGCTTCTGGAGGG - Intergenic
1039971083 8:42322253-42322275 GAGTTTCTGCAGCTGCTGACTGG + Intronic
1042721720 8:71833565-71833587 AACTTTAAGCAGGTGCTGAGGGG - Intronic
1044340887 8:91045036-91045058 AAAGGTATGCAGCTGCAAACAGG - Intergenic
1044707534 8:95023612-95023634 AAGTGTAGGCAGCTGCTGGCTGG + Intronic
1046198203 8:110890413-110890435 AGCTGTCTGCAGCTGCTGCTGGG + Intergenic
1052344806 9:27398913-27398935 AACTATATGCAATTGCTGATGGG + Intronic
1052739574 9:32380663-32380685 AACTGTAAGCAGCTGCCCAGAGG + Intergenic
1052739759 9:32382234-32382256 AACTGTAAGCAGCTGCCCAGAGG + Intergenic
1055874608 9:80927001-80927023 AATTTTCTGCAGCTGCTGTCTGG + Intergenic
1056331573 9:85525469-85525491 CTCTGTGTGCAGGTGCTGACAGG + Intergenic
1057868419 9:98699891-98699913 AATAGAATGCAGCTGCTTACTGG + Intronic
1188501709 X:30834048-30834070 AACCATCTGCAGCTGCTGCCTGG + Exonic
1190480525 X:50872306-50872328 TACTGCTAGCAGCTGCTGACTGG - Intergenic
1193736197 X:85159715-85159737 AACTGCATGCAGTTGCTGGAGGG + Intergenic
1196115198 X:111991727-111991749 AAATGAATTTAGCTGCTGACTGG + Intronic
1197726411 X:129779912-129779934 TCCTGTATGCTGCTGCTGCCGGG + Intergenic