ID: 1125174082

View in Genome Browser
Species Human (GRCh38)
Location 15:36800253-36800275
Sequence ATAACTAGGTTCTCTTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125174080_1125174082 7 Left 1125174080 15:36800223-36800245 CCAACATGCATAGATTGAGTGAG 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1125174082 15:36800253-36800275 ATAACTAGGTTCTCTTTCTTTGG 0: 1
1: 0
2: 0
3: 16
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125174082 Original CRISPR ATAACTAGGTTCTCTTTCTT TGG Intronic
902165876 1:14571327-14571349 ATAACTCGTTTCTTTCTCTTTGG - Intergenic
907835415 1:58104049-58104071 AGAAATAGGTCCTCTTTATTGGG - Intronic
907879442 1:58532255-58532277 ATAACTATGTTCTATTTTTAAGG + Intronic
908410631 1:63861090-63861112 ATAAAAAGGTTTTCTCTCTTTGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
911116605 1:94252273-94252295 ATAGCTTGGTTCCCTTTCTTGGG + Intronic
913241516 1:116834297-116834319 AGAAATAGATTCTTTTTCTTGGG - Intergenic
917823945 1:178796472-178796494 ATAATTATCTTCTCTTTGTTAGG + Intronic
917944083 1:179951495-179951517 ATAGCTATGTTTTCTTTCCTGGG + Intergenic
918916287 1:190643165-190643187 CTAAATATGTTCTCTGTCTTTGG + Intergenic
919873950 1:201847364-201847386 ATAAATAGTTTCCCTTTCCTTGG + Intronic
920557785 1:206916628-206916650 AGAACTAGTTTCTTTTTCCTGGG - Intronic
920565859 1:206972524-206972546 ACAAGTAGCTTTTCTTTCTTGGG - Intergenic
921787330 1:219246147-219246169 ATAACTCCATTCTCTTTCATGGG - Intergenic
922332642 1:224590825-224590847 ATAACCAGGATCTATCTCTTGGG - Intronic
922944075 1:229495390-229495412 CTCACTATGTGCTCTTTCTTTGG - Intronic
924119401 1:240781042-240781064 AAAACATGGTTCTCTTTCTATGG + Intronic
1063692000 10:8296216-8296238 ATCACGAGGATCTCTTTCTAGGG - Intergenic
1064520112 10:16191995-16192017 CTACATAGGTTCTGTTTCTTTGG - Intergenic
1064775148 10:18768535-18768557 AAAAGCAGGTTCTCTTTCATAGG - Intergenic
1065721540 10:28632759-28632781 CTAACTAGCATCTCTGTCTTTGG - Intergenic
1066344272 10:34567948-34567970 AAAACTAGATTCTCTTTTGTTGG - Intronic
1066526825 10:36289430-36289452 ATTTCTGGGTTCTCTTTCATTGG + Intergenic
1066572188 10:36785587-36785609 AAAAGTAGGTTCTCTATGTTGGG + Intergenic
1069043384 10:63717987-63718009 ATATCCATGTACTCTTTCTTTGG + Intergenic
1069204569 10:65665580-65665602 ATTACTAGGCTGTCTTTATTAGG + Intergenic
1071886213 10:89952677-89952699 CTAACTAGGTACTCTTTAGTAGG - Intergenic
1071929929 10:90457534-90457556 ATCACTAGGTTCTTTTTCCATGG + Intergenic
1072313085 10:94176045-94176067 ATAGATTGGTTTTCTTTCTTTGG + Intronic
1075171475 10:120119758-120119780 AGGACAAGGTTCTCTTTATTTGG - Intergenic
1078997530 11:16719443-16719465 ATAACTGGGTTTTCTTTCAGGGG - Intronic
1080340038 11:31251641-31251663 ATAAATAGATTCTGTTTCTATGG + Intronic
1080415894 11:32069830-32069852 AAATCTAGATTCTCTCTCTTAGG + Intronic
1081122253 11:39281987-39282009 ATTACTACGTTGTCTTTATTAGG + Intergenic
1083057906 11:59840901-59840923 TGAACTTGTTTCTCTTTCTTGGG - Intronic
1083224411 11:61275782-61275804 AAAACAAGGTTTTCTTTCCTGGG - Intronic
1086246662 11:84761192-84761214 CTAATCAGATTCTCTTTCTTGGG + Intronic
1086952514 11:92905399-92905421 ATACATTGGTTCTGTTTCTTTGG - Intergenic
1087461166 11:98450093-98450115 ATATATAGGTTCTGTTTCTCTGG - Intergenic
1088944696 11:114497921-114497943 ATAAACAGGTTTTCTTTTTTGGG + Intergenic
1089013868 11:115151155-115151177 AGAACTATGTTCTCTTTTGTTGG + Intergenic
1089947409 11:122491404-122491426 ATAAGTACCTTCTGTTTCTTGGG + Intergenic
1090527306 11:127551320-127551342 ATGACTAGGTTTTATTTGTTGGG + Intergenic
1091839624 12:3611459-3611481 ATAACTAGGGACTCATTCCTTGG + Intronic
1093376733 12:18437533-18437555 ATAATTGGGTTATCTTGCTTGGG + Intronic
1094734049 12:33212968-33212990 ATAACTACCTCCTCTTTCTTTGG - Intergenic
1095242311 12:39875676-39875698 ATAACTACATTCTCTTTCACAGG + Intronic
1095242452 12:39877562-39877584 ATAACTATATTCTCTTTCATAGG + Intronic
1095848391 12:46772755-46772777 GTAACTGGGCTCTCTTTCTTAGG - Intronic
1095849705 12:46788942-46788964 ATAACCCTGTACTCTTTCTTTGG - Intronic
1098633423 12:72752307-72752329 AGAATTAGGATTTCTTTCTTAGG + Intergenic
1098854943 12:75641795-75641817 ATAACTAGGTTCTCTGTTCAGGG - Intergenic
1099520774 12:83658595-83658617 GTAACTGGGTTCTCTTTTTAGGG - Intergenic
1104384799 12:128341202-128341224 AAAACTCTGTGCTCTTTCTTTGG + Intronic
1105422117 13:20262242-20262264 ATAACCATATGCTCTTTCTTGGG + Intergenic
1106368284 13:29105455-29105477 ATAGCTATTTTCTGTTTCTTGGG - Intronic
1108945075 13:56012242-56012264 ATAAATAGATGCTGTTTCTTTGG - Intergenic
1109350671 13:61176842-61176864 ATAACTTGGTTTTCCTTATTTGG + Intergenic
1109378935 13:61532889-61532911 ATAACAAGGTTATTTTTCTCTGG - Intergenic
1109646797 13:65269452-65269474 ATAATTAGGTGCTTTTTCATAGG - Intergenic
1112187889 13:97145471-97145493 ACACCTAGGTTCTTTTTCCTTGG - Intergenic
1114390942 14:22308113-22308135 AAGACTGGGTTCTCTTTCTTAGG - Intergenic
1114882599 14:26805450-26805472 CTAACTAGGTTTCCTTTCTTTGG + Intergenic
1115796070 14:36936963-36936985 ATGGCTAGGGTCTCTTTCTATGG + Intronic
1115800699 14:36990374-36990396 TTAATTAGTTTTTCTTTCTTTGG - Intronic
1115877513 14:37877081-37877103 GTAACTAGGTTTTGTTTTTTTGG + Intronic
1116975967 14:51116368-51116390 ATTATTAGTTTCTCTTTTTTTGG - Intergenic
1117519827 14:56540218-56540240 AGAACAAGGTTCTGTTTCTCTGG + Intronic
1117684513 14:58239489-58239511 ATAAATTGGTTCTTTTTCTTCGG + Intronic
1118113528 14:62749512-62749534 GTAACAAGATTCTCTTCCTTAGG + Intronic
1119476458 14:74933039-74933061 ATATGTAGGTCCTCTTTTTTTGG - Intergenic
1120399015 14:84004622-84004644 ATAATGAGATTGTCTTTCTTTGG + Intergenic
1121685765 14:95833920-95833942 AGAACTAGGTGCTCATCCTTCGG + Intergenic
1122195346 14:100080688-100080710 ATAACTAGAATTTCTCTCTTGGG - Intronic
1123191695 14:106578271-106578293 ATTAATAGGTTATCTTTGTTTGG - Intergenic
1125174082 15:36800253-36800275 ATAACTAGGTTCTCTTTCTTTGG + Intronic
1126314406 15:47354478-47354500 ATAACTTAGTTCTTTTTCTGTGG - Intronic
1130759251 15:86800838-86800860 ATAGCTTAGTTCTCTTTTTTGGG - Intronic
1131373729 15:91906268-91906290 CTAACTATGTGCTATTTCTTTGG + Intronic
1131712823 15:95074434-95074456 GTAACTAGATTCTCTTTTCTGGG - Intergenic
1133087350 16:3375285-3375307 AAAATCAGGTTCTCTTCCTTGGG - Intronic
1133880245 16:9774962-9774984 AGAACTAATTTCTCTTACTTTGG - Intronic
1134406505 16:13964157-13964179 ATAAATAGGATTACTTTCTTGGG + Intergenic
1135164304 16:20125250-20125272 ATAATTAGGCTCCCTTTCATGGG + Intergenic
1135764999 16:25169918-25169940 ATAAGTAGGTTCATTTTTTTGGG + Intronic
1137332472 16:47512779-47512801 ATCATTTGGTTCTCTGTCTTTGG + Intronic
1140211611 16:72975003-72975025 CTATCTCGATTCTCTTTCTTAGG + Intronic
1140826597 16:78712876-78712898 TTAATTAGGTTCTCTGTTTTGGG + Intronic
1141748805 16:85944652-85944674 AAAACTACAATCTCTTTCTTGGG + Intergenic
1143494604 17:7305215-7305237 AGACCTAGCTACTCTTTCTTGGG - Intergenic
1144486732 17:15672416-15672438 ATAACAGGGTTCTCTTTCGTGGG - Intronic
1144914289 17:18709881-18709903 ATAACAGGGTTCTCTTTCGTGGG + Intronic
1155449166 18:25945544-25945566 ATAAATAGCTTCACTTTTTTTGG - Intergenic
1156695425 18:39760752-39760774 ATAAAAAAGTTATCTTTCTTAGG + Intergenic
1156714735 18:39994364-39994386 TTGACTAGGGTCTCTTTCTGTGG - Intergenic
1156756474 18:40533592-40533614 ATAACTAATTTCATTTTCTTTGG + Intergenic
1156785807 18:40913535-40913557 ATATTTAGGTTCTGTCTCTTTGG + Intergenic
1157149338 18:45200052-45200074 ATCTATAGGTTTTCTTTCTTTGG + Intergenic
1158340410 18:56459980-56460002 ATAAATATTTTCTCTTTCTAAGG - Intergenic
1158364880 18:56722861-56722883 ATACCTAGGCTATCTTTATTGGG + Intronic
1159001584 18:62979566-62979588 ATCTGTAGGTTCTCTTTCTTTGG + Exonic
1159318300 18:66810161-66810183 ATAAATGGGTGCTATTTCTTGGG - Intergenic
1159342994 18:67160961-67160983 TAAAATAGGTTCTGTTTCTTCGG + Intergenic
1160301496 18:77685209-77685231 ATAAGTGGGTTCTCATACTTGGG + Intergenic
1161656240 19:5517038-5517060 ATAACTGGGCTCTCTTCCATGGG - Intergenic
1163650462 19:18514870-18514892 AAAACTAGGGTCTCTTCCCTGGG + Intronic
1163802781 19:19377351-19377373 ATAAATATGTTTTCTTTTTTGGG + Intergenic
1167943261 19:52964574-52964596 AGAACTAGGTCCTGTTTCTAGGG - Intergenic
925560923 2:5194338-5194360 ATAACTCTGTCCTCTGTCTTAGG - Intergenic
929619423 2:43339674-43339696 CTATCTAGTTTCTCCTTCTTTGG - Intronic
933501811 2:83121848-83121870 ATATCTAGGTTGTTTTTATTGGG - Intergenic
933991459 2:87637168-87637190 TTAGCTGGGTTCTCTATCTTGGG + Intergenic
936302384 2:111313654-111313676 TTAGCTGGGTTCTCTATCTTGGG - Intergenic
936446451 2:112599567-112599589 ATAAATATGTTTTCTTTATTTGG - Intergenic
937203224 2:120219153-120219175 ACAACTAGATTCCCATTCTTGGG - Intergenic
937735122 2:125278776-125278798 AGATCTTGGTTCTCTTTCTAGGG - Intergenic
938731114 2:134148737-134148759 GAAATTAAGTTCTCTTTCTTAGG + Intronic
940366955 2:152858945-152858967 AAAAGGAGGTTCTCTGTCTTGGG + Intergenic
940496932 2:154442037-154442059 ATAATTAGATTCTCTTTCAGTGG + Intronic
940629307 2:156217786-156217808 ATTACTAGTTTCTCTTCCTATGG + Intergenic
941206681 2:162581883-162581905 ATCACTACTTTTTCTTTCTTTGG - Intronic
941473058 2:165913901-165913923 ATATCTAGGTTCTCCTTATTTGG + Intronic
941664027 2:168225919-168225941 AAAACTAGATTCTCAATCTTTGG + Intronic
942410057 2:175700000-175700022 TTAACTAGATTCTTTATCTTAGG + Intergenic
942959176 2:181809379-181809401 ATAACTGGGTTCTCCTTTGTTGG - Intergenic
943083843 2:183288441-183288463 GAAACTAGATTCTCTTTCCTAGG + Intergenic
943642051 2:190370429-190370451 ATAACAAGTTTTTCTTTATTTGG - Intronic
944267104 2:197740514-197740536 ATAACTGGATTATCATTCTTTGG + Intronic
945211312 2:207385896-207385918 ATACATTGGTTCTGTTTCTTTGG - Intergenic
945561499 2:211346226-211346248 ATAACAAGGAACTCCTTCTTTGG - Intergenic
1170807566 20:19646185-19646207 ATAACTATTTTGACTTTCTTTGG - Intronic
1174753935 20:53139748-53139770 AAAACTTGGTTCTCTTTTTCTGG + Intronic
1178729512 21:35086914-35086936 ATAACTAGGCTCTTCTCCTTTGG - Intronic
1185091129 22:48774341-48774363 ATAACTTTGTTTTCTTTTTTTGG + Intronic
949424575 3:3903033-3903055 AAAACTAGTTTCTCAGTCTTTGG + Intronic
952601024 3:35083207-35083229 ATAAATTGGTTCTATTTCTCTGG - Intergenic
952658358 3:35815344-35815366 GTTACTAGCTTCTCTTTTTTAGG + Intergenic
953271572 3:41450510-41450532 ATAAGTAGGTTTACTTTCATAGG + Intronic
953806490 3:46074081-46074103 ATAACTATTTTCTTTTCCTTTGG - Intergenic
954537964 3:51375459-51375481 GTAGCTATGTTCTGTTTCTTGGG + Intronic
955664139 3:61332452-61332474 ATGATTAGGTTTTCTTTCCTAGG - Intergenic
955754128 3:62210759-62210781 ATAAATATGTTTTCTTCCTTAGG + Intronic
958499780 3:94890236-94890258 ATAAGAATGTTCTATTTCTTCGG - Intergenic
958816363 3:98920700-98920722 ATAACTAGCTTTTCTCTCTGAGG + Intergenic
960402311 3:117216543-117216565 ATAACTAAATCCTCTTTATTAGG + Intergenic
962393126 3:134990974-134990996 ATAACTTTCTTCTATTTCTTGGG + Intronic
963667354 3:148205406-148205428 ATAACTACATTGTATTTCTTAGG + Intergenic
963842422 3:150121175-150121197 AGACCTAGGTCCTCTTACTTAGG + Intergenic
964196571 3:154071702-154071724 ATAAGTTGGTTGTCTTTCTGTGG - Intergenic
965107937 3:164381939-164381961 TTAAGTAGGATCTCTTTATTAGG - Intergenic
965541348 3:169874626-169874648 ATATCTAGGTTTTTTCTCTTAGG - Intergenic
965907374 3:173725706-173725728 TTAGCTGGGTTCTCTTTCTCAGG + Intronic
966185928 3:177227210-177227232 ACAACTAGCTTCTCTTTTTCTGG + Intergenic
966998651 3:185310220-185310242 CTGACTAGATTCTCTCTCTTTGG + Intronic
970218567 4:13784550-13784572 ATTACCAGTATCTCTTTCTTGGG + Intergenic
970791103 4:19858992-19859014 ATACCTGTTTTCTCTTTCTTTGG - Intergenic
973171587 4:47151496-47151518 ATAACTAGCTTTGCTTTCTTGGG + Intronic
974084103 4:57241064-57241086 ATAAGAAAGTTCTCTTCCTTTGG - Intergenic
974874980 4:67692822-67692844 TTAATGATGTTCTCTTTCTTGGG - Intronic
976630084 4:87227656-87227678 ATAACTAAGTTATTTGTCTTTGG + Intronic
976699961 4:87959388-87959410 ATAACAGGGTTCTCTGTCTATGG + Intergenic
977408035 4:96625085-96625107 AAAACTATGTTCTCTTTATATGG + Intergenic
979339523 4:119504725-119504747 ATAAATTGTTTCTTTTTCTTTGG - Intronic
979373717 4:119919514-119919536 TTATCTAGGTTTTCTTTCTAGGG - Intergenic
979726202 4:123964882-123964904 ATAACCAGGTTAGCTTTCTATGG - Intergenic
982486880 4:155977016-155977038 ATACTTAGCTTCTTTTTCTTTGG + Intergenic
983058657 4:163129521-163129543 CTTGCTGGGTTCTCTTTCTTTGG - Intronic
983695811 4:170528945-170528967 ATACCCCGGTTCTGTTTCTTGGG + Intergenic
983844465 4:172499739-172499761 GTAAATAGCTTCTATTTCTTTGG - Intronic
984153425 4:176163755-176163777 ATTCCCAGGGTCTCTTTCTTTGG - Intronic
984339218 4:178432575-178432597 TTTACTAGGTTCTCTCTCATAGG + Intergenic
985060626 4:186074177-186074199 ATGACTGTGTTCTATTTCTTTGG - Intronic
985271752 4:188200041-188200063 ACAAGTAGGTTTTCATTCTTTGG - Intergenic
986248533 5:6033178-6033200 ATATCTTGATTCTGTTTCTTTGG - Intergenic
986270895 5:6229867-6229889 GCTACTAGATTCTCTTTCTTAGG + Intergenic
986427234 5:7645834-7645856 ATAACTAGGTTATCTGCCATGGG + Intronic
986722402 5:10569100-10569122 ATAACTGGATTCTCATTTTTGGG - Intronic
987913666 5:24184096-24184118 ATAAGTAAGTTCTCTTGATTTGG - Intergenic
988671042 5:33382069-33382091 ATAACAAAGTTCTATTTCTGAGG - Intergenic
989628703 5:43459020-43459042 ATAATCACATTCTCTTTCTTTGG - Intronic
991550035 5:67825837-67825859 ATAATAAGGTTGTCTTTCTAGGG - Intergenic
992282398 5:75194417-75194439 ATAATTAGTTTCTCTTTTTCTGG + Intronic
993978054 5:94506766-94506788 TAAAGTAGGTTCTCTATCTTTGG + Intronic
994426136 5:99589746-99589768 ATTATTTGGTTCTCTTACTTAGG - Intergenic
994584174 5:101684402-101684424 ATAACTAGGATTTGTTTCCTAGG + Intergenic
994797809 5:104328974-104328996 ATAACTAGTTTATTTTCCTTTGG + Intergenic
994924254 5:106093830-106093852 ATAAGTAGTTTTTCTTTCATAGG + Intergenic
995578266 5:113565411-113565433 GTGAATAGGTTCTCTTGCTTTGG - Intronic
996480265 5:123967873-123967895 ATATATAGGTTCTGTTTCTCTGG + Intergenic
996752345 5:126901599-126901621 AAAACTATGTATTCTTTCTTTGG + Intronic
997732138 5:136189452-136189474 GTAACTTGGTTCTCTTTTCTAGG - Intergenic
998771614 5:145552135-145552157 AGGACCAGGTTGTCTTTCTTGGG + Intronic
1001043993 5:168357084-168357106 ATCACAAGTTTCTCTTTGTTGGG + Intronic
1001946562 5:175783651-175783673 ATATATAGGTTCTGTTTCTCTGG + Intergenic
1003731991 6:8835402-8835424 ATAACCCTGCTCTCTTTCTTTGG + Intergenic
1004581476 6:16958398-16958420 ATAACCAAGTTTTTTTTCTTGGG + Intergenic
1005233084 6:23727499-23727521 ATTACTATGTTCTGTTTATTAGG - Intergenic
1008043869 6:46831984-46832006 CTAACAATGTTCTGTTTCTTAGG - Intronic
1008675613 6:53814981-53815003 GGAACTAGGCTGTCTTTCTTTGG + Intronic
1010317097 6:74464418-74464440 TTAAATTGGTGCTCTTTCTTGGG + Intergenic
1010467999 6:76191431-76191453 CTTACTAGCTTCTTTTTCTTTGG - Intergenic
1011303577 6:85902041-85902063 GTCACTAGGTTCTCTTCCTAGGG - Intergenic
1012087130 6:94842376-94842398 ATAATTAGGTATTCTTTCTAGGG - Intergenic
1012798082 6:103789254-103789276 ATAACTAGGATTTCTTTGTAAGG - Intergenic
1013800864 6:113940579-113940601 ATAACTATTTGCTGTTTCTTTGG - Exonic
1013937274 6:115612889-115612911 ATAGCTAGGTGTTCTTTCTCAGG - Intergenic
1014392583 6:120881461-120881483 ATAACTAACTTCTCATGCTTCGG + Intergenic
1014630519 6:123783886-123783908 AATACTAGGGTCTTTTTCTTTGG - Intergenic
1014670802 6:124301614-124301636 ATAGGTGGGTTCTCATTCTTGGG - Intronic
1017383653 6:153858469-153858491 CTAACAAGGATCTCTTGCTTTGG - Intergenic
1017933524 6:158982456-158982478 ATAATTATATTTTCTTTCTTAGG - Intronic
1021953763 7:25802878-25802900 ATACCTACCTACTCTTTCTTTGG - Intergenic
1024363958 7:48500198-48500220 ATAGCTATCCTCTCTTTCTTTGG + Intronic
1024422978 7:49191457-49191479 ACAACCAGCTTCTCTCTCTTAGG + Intergenic
1026659254 7:72284887-72284909 ATAGATAGATTCTGTTTCTTTGG + Intronic
1030241740 7:107333968-107333990 AGAACTATTTTCTCTCTCTTGGG + Intronic
1030670295 7:112328103-112328125 TTAACAATGTTCTATTTCTTAGG - Intronic
1030770154 7:113464426-113464448 ATGATTAGGTTCTTATTCTTGGG + Intergenic
1031250190 7:119370494-119370516 CTAACTATGTTCTCTGGCTTTGG - Intergenic
1031865388 7:127033235-127033257 ATAGCAATATTCTCTTTCTTTGG + Intronic
1032808160 7:135379143-135379165 CTAACCAGTTTCTTTTTCTTTGG - Intronic
1037347456 8:17915213-17915235 ATAAATAGCTTCTCTATTTTAGG + Intergenic
1038578621 8:28727461-28727483 ACAAGTAGGTTCTCTTGATTTGG + Intronic
1039781085 8:40786352-40786374 ATAACTTGTTTTTCTTTTTTTGG - Intronic
1039945544 8:42125694-42125716 ATAACTACTTTCTACTTCTTGGG - Intergenic
1040645255 8:49389573-49389595 ATAACTATGTTTTCCTTCTTAGG + Intergenic
1042539536 8:69894273-69894295 ATCACTAGGTTATCTTTCCGAGG + Intergenic
1044166706 8:88993504-88993526 ATTATTAGGTTTTTTTTCTTAGG + Intergenic
1044908643 8:97032533-97032555 ATAGCTATATTCTCTATCTTTGG + Intronic
1045441862 8:102221751-102221773 ATTTCTAGGTTGTCCTTCTTGGG + Intronic
1046009769 8:108532217-108532239 ATAACAAAATACTCTTTCTTGGG + Intergenic
1046373760 8:113348382-113348404 ATCACCAGGTTGTCTTTGTTTGG - Intronic
1048603097 8:135939917-135939939 ATTACAAGGTGCTCTTTCTCAGG + Intergenic
1050768532 9:9166823-9166845 ATAGGTAGGTTGTCTTTTTTTGG - Intronic
1050912470 9:11089775-11089797 ATATCTAGTTTCTTTTTCTTTGG - Intergenic
1051137179 9:13935397-13935419 ATAACTGTCTTCTTTTTCTTTGG + Intergenic
1051613792 9:18987596-18987618 AAAACTCGATTCTCTTCCTTGGG + Intronic
1052330107 9:27259229-27259251 ATAACTGGGTGATTTTTCTTGGG - Intergenic
1052390368 9:27872256-27872278 ATAACTGGTTTCACTTTCTCTGG + Intergenic
1055194686 9:73574643-73574665 ATAAATATGTTTACTTTCTTAGG - Intergenic
1055370959 9:75598821-75598843 ATCAATAGGTACACTTTCTTTGG - Intergenic
1056115573 9:83438233-83438255 ATTTCTGGGTTCTGTTTCTTTGG - Intronic
1056673413 9:88651552-88651574 ATAAATAGGTTTCCTTTCTGAGG - Intergenic
1057297170 9:93854859-93854881 ATAAATTGATTCTCTTTCTCTGG + Intergenic
1057753358 9:97809974-97809996 ATAATTATGTTCCCTGTCTTGGG - Intergenic
1058140264 9:101350371-101350393 ATAAATAGTTTCAGTTTCTTTGG + Intergenic
1058635646 9:107035821-107035843 ATAACTAGGTTTTCTGATTTTGG - Intergenic
1060534323 9:124371611-124371633 TTATCTAGGTTGTCTTTTTTCGG - Intronic
1187146995 X:16646102-16646124 ATAAGAAGGTTCTTTTTCTGAGG - Intronic
1187749286 X:22444264-22444286 ATAATTAGCTTATCTATCTTGGG - Intergenic
1188378163 X:29458633-29458655 ATAAATAGTTTCTCTTTATTAGG + Intronic
1189704425 X:43745694-43745716 AAAACTAAGTTCTCTATCTTAGG + Exonic
1190241921 X:48663478-48663500 TTAGCTAGGTTCTCTGTCTCTGG - Intergenic
1193395049 X:80973833-80973855 ATAACTTGCTTCTCTGTGTTTGG + Intergenic
1193449924 X:81653146-81653168 GTAACTAGGTAATTTTTCTTGGG - Intergenic
1195141419 X:101964419-101964441 ATACCTAGGTGCTATATCTTGGG - Intergenic
1195281175 X:103334657-103334679 ATAACTATGATTACTTTCTTAGG - Intergenic
1195526983 X:105902520-105902542 ATAACAAAATTCTCTTCCTTTGG + Intronic
1196311234 X:114168286-114168308 AGAACTAAGTTCAGTTTCTTAGG + Intergenic
1196319076 X:114267419-114267441 ATAACCAGTTTCTATTACTTAGG - Intergenic
1196351002 X:114729506-114729528 ATAACTTGCTTCTGTTTATTTGG + Intronic
1196639849 X:118046049-118046071 ATACATAGATTTTCTTTCTTTGG - Intronic
1198307428 X:135396876-135396898 ATACCTAGTTTCTGTTTCTAAGG - Intergenic
1198693620 X:139311579-139311601 ATAACCTCTTTCTCTTTCTTAGG - Intergenic
1199007975 X:142724595-142724617 ATAACTTGGCTCTCTCTGTTTGG - Intergenic