ID: 1125176687

View in Genome Browser
Species Human (GRCh38)
Location 15:36830560-36830582
Sequence GTGTGTGAACAAGAGAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125176685_1125176687 26 Left 1125176685 15:36830511-36830533 CCAGCCTGATAGAATATCTTTGA No data
Right 1125176687 15:36830560-36830582 GTGTGTGAACAAGAGAAAGTTGG No data
1125176686_1125176687 22 Left 1125176686 15:36830515-36830537 CCTGATAGAATATCTTTGAACAT No data
Right 1125176687 15:36830560-36830582 GTGTGTGAACAAGAGAAAGTTGG No data
1125176684_1125176687 27 Left 1125176684 15:36830510-36830532 CCCAGCCTGATAGAATATCTTTG No data
Right 1125176687 15:36830560-36830582 GTGTGTGAACAAGAGAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125176687 Original CRISPR GTGTGTGAACAAGAGAAAGT TGG Intergenic
No off target data available for this crispr