ID: 1125177466

View in Genome Browser
Species Human (GRCh38)
Location 15:36841310-36841332
Sequence TGGTGCTGAAAAGCAATCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125177466_1125177469 -2 Left 1125177466 15:36841310-36841332 CCAGCGATTGCTTTTCAGCACCA No data
Right 1125177469 15:36841331-36841353 CACTGCTTCCGGCTGCTAACAGG No data
1125177466_1125177471 0 Left 1125177466 15:36841310-36841332 CCAGCGATTGCTTTTCAGCACCA No data
Right 1125177471 15:36841333-36841355 CTGCTTCCGGCTGCTAACAGGGG No data
1125177466_1125177470 -1 Left 1125177466 15:36841310-36841332 CCAGCGATTGCTTTTCAGCACCA No data
Right 1125177470 15:36841332-36841354 ACTGCTTCCGGCTGCTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125177466 Original CRISPR TGGTGCTGAAAAGCAATCGC TGG (reversed) Intergenic
No off target data available for this crispr