ID: 1125177469

View in Genome Browser
Species Human (GRCh38)
Location 15:36841331-36841353
Sequence CACTGCTTCCGGCTGCTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125177466_1125177469 -2 Left 1125177466 15:36841310-36841332 CCAGCGATTGCTTTTCAGCACCA No data
Right 1125177469 15:36841331-36841353 CACTGCTTCCGGCTGCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125177469 Original CRISPR CACTGCTTCCGGCTGCTAAC AGG Intergenic
No off target data available for this crispr