ID: 1125178328

View in Genome Browser
Species Human (GRCh38)
Location 15:36851788-36851810
Sequence CATTTCCACCAAAAGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125178328_1125178331 0 Left 1125178328 15:36851788-36851810 CCCCAGCACTTTTGGTGGAAATG No data
Right 1125178331 15:36851811-36851833 AAGCCTGCCATTATGAGCTCTGG No data
1125178328_1125178332 1 Left 1125178328 15:36851788-36851810 CCCCAGCACTTTTGGTGGAAATG No data
Right 1125178332 15:36851812-36851834 AGCCTGCCATTATGAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125178328 Original CRISPR CATTTCCACCAAAAGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr