ID: 1125182086

View in Genome Browser
Species Human (GRCh38)
Location 15:36888748-36888770
Sequence CAGCAATTTGATAAGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125182086_1125182089 -7 Left 1125182086 15:36888748-36888770 CCAGGCTCCTTATCAAATTGCTG No data
Right 1125182089 15:36888764-36888786 ATTGCTGGCCTGCTAGCTAATGG No data
1125182086_1125182091 4 Left 1125182086 15:36888748-36888770 CCAGGCTCCTTATCAAATTGCTG No data
Right 1125182091 15:36888775-36888797 GCTAGCTAATGGAGAACTTGTGG No data
1125182086_1125182092 7 Left 1125182086 15:36888748-36888770 CCAGGCTCCTTATCAAATTGCTG No data
Right 1125182092 15:36888778-36888800 AGCTAATGGAGAACTTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125182086 Original CRISPR CAGCAATTTGATAAGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr