ID: 1125182500

View in Genome Browser
Species Human (GRCh38)
Location 15:36893745-36893767
Sequence CTGCATTAGTAAAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 358}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125182500 Original CRISPR CTGCATTAGTAAAGGAAGGA AGG Intronic
901362818 1:8718126-8718148 CTGCTTTAGTAAAGAAATGGAGG - Intronic
903054775 1:20628030-20628052 CTGAATTTCAAAAGGAAGGAAGG - Intergenic
905540668 1:38757925-38757947 CTGAATAAATGAAGGAAGGAAGG + Intergenic
907234345 1:53031438-53031460 CTGCATTAGCAAAGGCAGCCTGG + Intronic
907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG + Intergenic
908007550 1:59742220-59742242 CTGCCTTAGTTAAGGAGGCAGGG - Intronic
909688904 1:78383050-78383072 ATGCATCTGTAAAGAAAGGAAGG + Intronic
910954628 1:92688556-92688578 CCACTTTATTAAAGGAAGGAAGG - Intronic
911519826 1:98915763-98915785 CTGATTTAGTAAATGAAGAATGG + Intronic
911762400 1:101631379-101631401 CTGCTTGAATAAAGGAAGGAAGG - Intergenic
913029199 1:114881531-114881553 CTCCATCAAGAAAGGAAGGAAGG - Intronic
913329709 1:117657066-117657088 ATGAATGAATAAAGGAAGGAAGG - Intergenic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
917460096 1:175222159-175222181 CTGGATAAGTGAAGGAGGGAAGG + Intergenic
919229293 1:194753082-194753104 TTACATTAGTAAAGAAAGGCAGG - Intergenic
919745887 1:201008952-201008974 CTGCATTGGCAAAGATAGGAGGG + Intronic
920173692 1:204087227-204087249 CTGCAGAAGTCATGGAAGGAAGG - Intronic
920534694 1:206729872-206729894 CTGGATGAGTAGAGGAAGGGAGG + Intronic
920574336 1:207046951-207046973 CTGAAGTAGCAAAGAAAGGAAGG + Exonic
921884072 1:220287036-220287058 CACCATTAGATAAGGAAGGAAGG - Intergenic
923489832 1:234474921-234474943 CTGAATTCTAAAAGGAAGGAAGG + Intronic
923637662 1:235717043-235717065 CTGCAGAAGTAAGGGAAAGAAGG - Intronic
923706666 1:236349776-236349798 CTGGATCTGGAAAGGAAGGAAGG + Intronic
924427842 1:243970222-243970244 CTGCCATATGAAAGGAAGGAAGG + Intergenic
1062783441 10:238860-238882 CTGCATGAGTAAAGGCAGTGGGG - Intronic
1062808087 10:439694-439716 CTTCATTAGTAAAGGTATAAAGG + Intronic
1065485987 10:26237064-26237086 CTGCAGCACTAAAGGAAGGGAGG - Intronic
1066284010 10:33946310-33946332 CTGAATATGTAAAAGAAGGAAGG + Intergenic
1067515907 10:46943366-46943388 CAGTATTAGACAAGGAAGGAAGG + Intronic
1067646343 10:48108444-48108466 CAGTATTAGACAAGGAAGGAAGG - Intergenic
1067813907 10:49456458-49456480 TTTTATTAGTAAAGGAAGAATGG + Exonic
1067830108 10:49606870-49606892 TTGAATGAGTAGAGGAAGGAAGG - Intergenic
1067955891 10:50790094-50790116 CTGCCTTTGGAAAGGCAGGAAGG + Intronic
1069048374 10:63766367-63766389 CTGGATCTGAAAAGGAAGGAAGG - Intergenic
1069178616 10:65327011-65327033 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1069638037 10:69937526-69937548 TGGCATTTGTAGAGGAAGGAGGG - Intronic
1069952557 10:72029581-72029603 CTGCACTAGTACAGGAGGCAAGG + Intergenic
1071140790 10:82507191-82507213 CTGCATAAGTTTAGGAAGCATGG - Intronic
1072765892 10:98095026-98095048 CTGAGTTGGTAAAGGAATGAAGG + Intergenic
1074184109 10:111086391-111086413 TTGAATGAATAAAGGAAGGAAGG - Intergenic
1074215164 10:111377088-111377110 CTGCATCTGGAAATGAAGGAAGG + Intergenic
1074850054 10:117432443-117432465 CTACATGAGGAAAGGCAGGAGGG - Intergenic
1075323695 10:121512768-121512790 ATGAATAAATAAAGGAAGGAGGG + Intronic
1076094672 10:127721257-127721279 CTGCTTTGGAAAAGGGAGGAAGG + Intergenic
1076125981 10:127974245-127974267 CTGGGTTAGTAAAGGAGGTAAGG - Intronic
1076523340 10:131094738-131094760 TTACATCAGTAAAGGAAGGAAGG - Intronic
1076576208 10:131470965-131470987 CTGCATTAGAAAAACAAAGAGGG - Intergenic
1076867610 10:133175752-133175774 ATGGATTAGTAGAGGATGGACGG + Intronic
1077846461 11:6030457-6030479 CTACATTATGAAAGGAAGGAAGG + Intergenic
1080314784 11:30936503-30936525 CTGCATGAGCTTAGGAAGGAAGG - Intronic
1080350200 11:31375647-31375669 CTTCATTGTTACAGGAAGGAAGG + Intronic
1080913689 11:36632001-36632023 CTGCATTAATGCAGGAAGCAAGG + Intronic
1081997090 11:47372713-47372735 CTGCATTCCTCAAGGCAGGAGGG - Intronic
1083790260 11:64980236-64980258 GAGCATTTGAAAAGGAAGGATGG + Intergenic
1083975244 11:66113848-66113870 ATGTATTAATAAAGGAAGAAAGG - Intronic
1084147057 11:67270553-67270575 CTGCAGGAGTGAAGGAAGGAGGG - Intronic
1084754341 11:71225420-71225442 CGGCATTAGTATAGGCAGCATGG + Intronic
1084953533 11:72679472-72679494 CTGCATTGGTCTAGGAGGGATGG + Intergenic
1085084303 11:73656487-73656509 CTGAGTGAGCAAAGGAAGGAAGG + Intronic
1085186283 11:74578720-74578742 CTCCATTAAGGAAGGAAGGAGGG + Intronic
1085261638 11:75208857-75208879 CTGAATGAATGAAGGAAGGAAGG - Intergenic
1085429073 11:76430989-76431011 CTGAATTAGTAATGAAAGAATGG + Intergenic
1086184108 11:83992745-83992767 CTGAATTAGAAAAGGAGGAAAGG + Intronic
1086755368 11:90555059-90555081 GTGCATTCATAAAGGAAGGAAGG + Intergenic
1087166100 11:95004802-95004824 CAGAATGAATAAAGGAAGGAAGG - Intergenic
1088212840 11:107475415-107475437 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1092083854 12:5739677-5739699 CTGGAGAAGTAAAGTAAGGATGG + Intronic
1093416826 12:18929699-18929721 CTTTATTAGTACAGGAAGCAGGG - Intergenic
1093429446 12:19067700-19067722 ATGAATGAATAAAGGAAGGAGGG + Intergenic
1093512694 12:19948068-19948090 TGGCATTAGTAAAGGAAGAAAGG - Intergenic
1093709165 12:22309785-22309807 CTGGATCAGTGAAGAAAGGAGGG + Intronic
1094237702 12:28187429-28187451 CTGAATTAGTTAAGCAAGGTTGG - Intronic
1094589618 12:31808288-31808310 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1094618641 12:32059211-32059233 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1094644775 12:32311791-32311813 CTGGATCTGGAAAGGAAGGAAGG + Intronic
1095113077 12:38319305-38319327 CAGCATAAGCAAAGGAAGAAAGG + Intronic
1097104132 12:56610759-56610781 CTGATTTTGTAAAGGAGGGATGG - Intronic
1097808780 12:63994848-63994870 CAGCATGAGTAATGGAAAGAAGG - Intronic
1098831110 12:75364186-75364208 CTGAATTACAAAAGGGAGGAAGG + Intronic
1099712768 12:86248238-86248260 CTGCCTGAGAGAAGGAAGGAAGG - Intronic
1101377089 12:104180631-104180653 ATGCATAAGTAAATGAAAGAAGG - Intergenic
1104300200 12:127558004-127558026 CTTCTTTAGTAGAGGCAGGATGG - Intergenic
1104350425 12:128040482-128040504 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1104441232 12:128794919-128794941 CTGCCTCAGAAAAGGCAGGAAGG - Intronic
1104603208 12:130167589-130167611 CATCACTAGTGAAGGAAGGAAGG + Intergenic
1104603226 12:130167743-130167765 CATCACTAGTGAAGGAAGGAAGG + Intergenic
1106119782 13:26850588-26850610 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1106429087 13:29662464-29662486 CTGGATTTGGAAAGGAAGGAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107087610 13:36443103-36443125 ATAGATTAGTAAAGGAAGGAAGG + Intergenic
1107362884 13:39639025-39639047 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1108894118 13:55301560-55301582 CTGCATTGGTAGAGAAAGAAAGG - Intergenic
1109442880 13:62398058-62398080 CTGAATTCCCAAAGGAAGGAGGG - Intergenic
1110172051 13:72512622-72512644 CTGGATTAGTAGAGGAGGAATGG + Intergenic
1111497020 13:89064086-89064108 ATGCATTAGAAAAAGATGGATGG + Intergenic
1112079566 13:95954391-95954413 CTGAATTCCAAAAGGAAGGAGGG - Intronic
1113742725 13:112722541-112722563 CTGAATTCCAAAAGGAAGGAGGG + Intronic
1116609691 14:47052215-47052237 TTGCATTAGAAAAGAAAGAAGGG + Intronic
1120075856 14:80157604-80157626 CTGGATTAGGAAAGGACGCAGGG - Intergenic
1120152132 14:81048177-81048199 CAGCTTTAGTGAAGGAAGTAGGG - Intronic
1120664931 14:87294763-87294785 GTCAATTGGTAAAGGAAGGAAGG + Intergenic
1120771361 14:88383908-88383930 CTGGATTTGGAAAGGAAAGAAGG + Intergenic
1121023468 14:90597293-90597315 TTGAATTAGTATTGGAAGGAGGG + Intronic
1121377108 14:93422469-93422491 CTGAATTCCAAAAGGAAGGAGGG + Intronic
1123115015 14:105890633-105890655 CTGCCCCAGGAAAGGAAGGAAGG + Intergenic
1125182500 15:36893745-36893767 CTGCATTAGTAAAGGAAGGAAGG + Intronic
1125743139 15:41981443-41981465 CTGCATGAGAAAAGGTGGGATGG + Intergenic
1125751176 15:42030118-42030140 TGGCATGAGTAAAGGAATGAAGG + Intronic
1125907165 15:43403642-43403664 TGGCATTAGGAAAGGAAGGAAGG - Exonic
1126163125 15:45632224-45632246 CTCCATCAAAAAAGGAAGGAAGG - Intronic
1126544369 15:49856527-49856549 ATGCTGTAGGAAAGGAAGGAAGG + Intergenic
1126645042 15:50867449-50867471 CTGGATCTGCAAAGGAAGGAAGG + Intergenic
1126980546 15:54237891-54237913 CAGCATTTGTAAAGATAGGAAGG - Intronic
1127726590 15:61756550-61756572 CTTCATGAGTAAAGAGAGGAGGG - Intergenic
1128469524 15:67940486-67940508 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1129195514 15:73963266-73963288 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129920411 15:79314849-79314871 CTGCATATGAAAGGGAAGGAGGG - Intronic
1129941152 15:79497656-79497678 CTGCTTTAGAAAAGGTAGGAGGG + Intergenic
1131075420 15:89492361-89492383 CTGCATCAGCACACGAAGGATGG + Intronic
1131818016 15:96243049-96243071 CTTCAGTAGTTATGGAAGGAAGG - Intergenic
1133987272 16:10677945-10677967 CTACATTAGCAAAGGCAGGCAGG + Intronic
1135226119 16:20659686-20659708 CTGGATATGGAAAGGAAGGAAGG - Intronic
1137995673 16:53208552-53208574 CAGCACTGGGAAAGGAAGGAGGG - Intronic
1139651874 16:68366255-68366277 CTGCAGCAGTGAAGGAAGGACGG - Intronic
1140449932 16:75062822-75062844 CTGCATTAGAAAAGGCAAGGGGG - Intronic
1140807093 16:78542801-78542823 CTGCATTAAGAAAGAAAGAAAGG - Intronic
1140951553 16:79823336-79823358 CCCCATTATTAAAAGAAGGAAGG + Intergenic
1141581860 16:85004713-85004735 GTGAATAAGTAAGGGAAGGAGGG + Intronic
1143625123 17:8105346-8105368 ATGCATTAGTAGCTGAAGGAAGG - Intronic
1145718974 17:27050266-27050288 CTGCAGTAGTAATGGCAGAAGGG - Intergenic
1145813037 17:27776172-27776194 CTGCATGAGTCAAGGCAGGGAGG + Intronic
1146807738 17:35878640-35878662 CTGGAAGAGGAAAGGAAGGAGGG + Intronic
1147040459 17:37714359-37714381 TTGCATTGGTGAAGGAAGAAGGG - Intronic
1147302646 17:39542053-39542075 CTTCTTCAGGAAAGGAAGGATGG + Intronic
1148978559 17:51550727-51550749 CTGAATCACTAAAGGGAGGAAGG + Intergenic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1151017450 17:70573051-70573073 CTGAATCAGTAAATGAATGAAGG - Intergenic
1151877034 17:76872733-76872755 GTGCATGAGTGAAGGAAGCAAGG - Exonic
1153217046 18:2830405-2830427 ATGCACTAGTAAAGTCAGGAAGG - Intergenic
1153239186 18:3015253-3015275 CTGAATGATGAAAGGAAGGAAGG - Intergenic
1153347192 18:4039635-4039657 CTGTATTTGTAAAGTAAGCATGG + Intronic
1154359270 18:13645459-13645481 CTGCAGCAGTAACGGGAGGATGG + Exonic
1155836195 18:30587775-30587797 CTGCCTTATAAAAGGAAGGAAGG - Intergenic
1156535595 18:37861766-37861788 CTTCATTAATAAAGGAAGAATGG + Intergenic
1156651541 18:39232605-39232627 CTGCATTTATAAAGAAAGAAAGG - Intergenic
1156764341 18:40633109-40633131 CTGCATGAAGAAAGGAAAGAAGG + Intergenic
1157092537 18:44653065-44653087 CTGCATTGGTGGAGGCAGGAGGG - Intergenic
1157428766 18:47606051-47606073 CTGAATCTGGAAAGGAAGGAAGG + Intergenic
1157954726 18:52084169-52084191 CTGAATTCCAAAAGGAAGGAAGG - Intergenic
1158050770 18:53216024-53216046 CTACATTTATAAAGGAAGAATGG - Intronic
1158616923 18:58996469-58996491 CTGCATAACTAAAGGAAGCCAGG + Intergenic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1158956068 18:62540189-62540211 CTGCATTATTGCAGGAAGAATGG - Intronic
1159195895 18:65113592-65113614 CTACATTAGTAGGGGAGGGAAGG + Intergenic
1160209659 18:76866364-76866386 CTGCATTAGGAAAAGAAGCATGG + Intronic
1160537247 18:79601261-79601283 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1160620903 18:80169900-80169922 AGAAATTAGTAAAGGAAGGAAGG + Exonic
1163468622 19:17484137-17484159 CTGAATGAATGAAGGAAGGAGGG + Intronic
1164434304 19:28215930-28215952 ATGAATGAGTAAAGGAAGGCAGG + Intergenic
1165545430 19:36531151-36531173 ATGCATTTATAATGGAAGGAAGG + Intergenic
1166154584 19:40901384-40901406 CTGCATTAGAAAAGCAAGGCTGG + Intergenic
1166173532 19:41049208-41049230 CTGCATTAGAAAAGCAAGGCTGG - Intergenic
1168080661 19:54007925-54007947 TTGAATTAGGAAAGGAATGAAGG + Intronic
1168083037 19:54024309-54024331 CTGCCTCATAAAAGGAAGGAAGG - Intergenic
1168218010 19:54940450-54940472 CTGCAGGTGAAAAGGAAGGATGG - Exonic
925800259 2:7592003-7592025 CTAGATTTGGAAAGGAAGGAAGG + Intergenic
925995298 2:9287847-9287869 CTGCATTAGTCATGGAAGGAGGG + Intronic
926270120 2:11359246-11359268 TTTCATAAGTAAAGAAAGGAGGG - Intergenic
927103267 2:19804204-19804226 ATGGATGATTAAAGGAAGGAGGG + Intergenic
927656214 2:24948834-24948856 CTGAATTAGAAAAGGAAGGTGGG - Intronic
927900665 2:26816033-26816055 CTATATTATTAAAGGAAGCATGG + Intergenic
929813438 2:45211801-45211823 TGGCATGAGGAAAGGAAGGAGGG - Intergenic
930666322 2:54102445-54102467 CTGCAATAGAAGAGGAATGAGGG - Intronic
930731817 2:54735082-54735104 CTGCATAAGTGGAGAAAGGAGGG - Intronic
930809533 2:55526014-55526036 CCGCATTATGAAAGGAATGATGG - Intronic
930905716 2:56564479-56564501 CTGTTTTAGTAAAGGAAGATAGG - Intergenic
930998249 2:57748892-57748914 CTGCTTTAGTGAAGGGAAGATGG - Intergenic
931541389 2:63333406-63333428 CTGGATCTGCAAAGGAAGGAAGG - Intronic
932058624 2:68472239-68472261 CTGGATCTGGAAAGGAAGGAAGG + Intronic
932434857 2:71697254-71697276 CTGCCTTAGACAAGGAAGCAGGG - Intergenic
933453161 2:82483148-82483170 ATGAATTAATGAAGGAAGGAAGG - Intergenic
933591547 2:84238599-84238621 CTGCATTAAGAATGGAAGAAAGG - Intergenic
935670927 2:105556638-105556660 CTCCAATAGTGAAGGAAGGGAGG - Intergenic
937865744 2:126750588-126750610 CTCTTTTAGTAAAGGAAGAATGG + Intergenic
938601991 2:132851663-132851685 CTGCATGGGTCAAGGAAGGGAGG - Intronic
938940198 2:136163038-136163060 TATCATTTGTAAAGGAAGGAAGG - Intergenic
939250275 2:139673537-139673559 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
939608233 2:144278406-144278428 CTGTAGTATGAAAGGAAGGAAGG + Intronic
939641238 2:144642419-144642441 GAGCCTTAGTAAAGGAAGGAGGG - Intergenic
940133880 2:150414195-150414217 CTGCCTTAAGTAAGGAAGGAAGG + Intergenic
941699127 2:168585263-168585285 ATGAATGAGTGAAGGAAGGAGGG - Intronic
942308700 2:174633919-174633941 TTGTGTTAGTAAAAGAAGGAAGG + Intronic
942408850 2:175685351-175685373 CAGCATGAGCAAAGGAAGAAAGG - Intergenic
942445096 2:176072272-176072294 CTGCATTTGTGTAGGTAGGAAGG - Intergenic
943221675 2:185117343-185117365 CTGCAAAAGTACAGAAAGGAAGG + Intergenic
944649522 2:201815466-201815488 CTTAATTAGCAAAGGAATGAGGG - Intronic
944997280 2:205308255-205308277 CTGTCTTAATAAAGGAAGGAAGG + Intronic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
946520392 2:220458136-220458158 CTCCATGAGTAAATAAAGGAAGG - Intergenic
947226908 2:227849374-227849396 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
948313918 2:237012325-237012347 CTGCATGAGAAGAGGAAGGGAGG + Intergenic
948819773 2:240535479-240535501 CTGCATCTGGAAAGAAAGGAAGG + Intronic
1169304428 20:4476160-4476182 CTGGATTTGGAAAGAAAGGAAGG + Intergenic
1169577284 20:6979240-6979262 CTGTAGCAGTAAAGGAAGAAAGG + Intergenic
1171974489 20:31585731-31585753 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
1172840384 20:37899512-37899534 CTCCATCTGTAAAAGAAGGAAGG + Intergenic
1173079613 20:39853123-39853145 CTGGTATAGCAAAGGAAGGAAGG - Intergenic
1173497686 20:43531094-43531116 CTGCAGTAGCAAAGGAGGGAGGG - Intronic
1173754314 20:45501599-45501621 CTGAATTATAGAAGGAAGGAAGG - Intergenic
1175592098 20:60201273-60201295 CTGGATTAGAAAAGGAAGAGGGG + Intergenic
1177435552 21:21048066-21048088 CTGGATTTGGAAAGGAAAGAAGG - Intronic
1178386327 21:32153629-32153651 CTGGATTTGGGAAGGAAGGAAGG + Intergenic
1178914844 21:36700398-36700420 ATGCATTGGCAAAGGAAGGAAGG - Intronic
1179008497 21:37534780-37534802 CTGCATCAGCAAAGGTAGGAAGG + Intergenic
1179363240 21:40732255-40732277 CTTCATTCTTAAAGGAAGGGAGG - Intronic
1181737494 22:24893200-24893222 ATGAATGAATAAAGGAAGGAGGG + Intronic
1183272382 22:36870299-36870321 ATGCATTAGTAAAGAGAGGAGGG + Intronic
1183657048 22:39192322-39192344 CTGCATTAGCAGGGGAAGCAAGG - Intergenic
1183680350 22:39325017-39325039 CTGGATTAGGAGAGGATGGAAGG + Intergenic
1183851679 22:40594626-40594648 CCACATTAGGAAAGGAGGGAGGG + Intronic
1184633198 22:45802609-45802631 CTGCATTAGGAAAGGATACAAGG - Intronic
1184892036 22:47386022-47386044 CTGGATGAATAAATGAAGGAAGG - Intergenic
949929163 3:9064714-9064736 GTGCAAAAGTAAAGGAAGGCAGG - Intronic
950640974 3:14347766-14347788 CTGCATTGGGAAAGGAAAGTGGG - Intergenic
951479740 3:23147608-23147630 CTGCACTGGTGAAGGAAGAAGGG + Intergenic
952692457 3:36225951-36225973 ATGAATTTATAAAGGAAGGAAGG - Intergenic
953429635 3:42828486-42828508 CTGCATTGTGGAAGGAAGGAAGG - Intronic
953485361 3:43289395-43289417 AAGCATTTGAAAAGGAAGGAGGG + Intronic
955250609 3:57278409-57278431 CTTCAACAGTATAGGAAGGATGG + Exonic
956357338 3:68408633-68408655 CTGAATAATGAAAGGAAGGAAGG - Intronic
958456877 3:94343402-94343424 ATGCTGTAGCAAAGGAAGGAAGG - Intergenic
958868716 3:99532173-99532195 CTGAAAGAGTAAATGAAGGAAGG + Intergenic
959240325 3:103783892-103783914 CTGCATTAGTATAATCAGGAGGG + Intergenic
959387704 3:105732769-105732791 CTGCATGAGTTGAGGAAGGATGG - Intronic
959752850 3:109858843-109858865 CTGAATTCCAAAAGGAAGGAGGG + Intergenic
960292330 3:115900628-115900650 CTGCATCATGAAAGGATGGAAGG + Intronic
960419519 3:117426637-117426659 CCCCAGTGGTAAAGGAAGGAAGG - Intergenic
960814212 3:121656978-121657000 ATGCCTTACTAAAGGAAGGGAGG + Intronic
961734751 3:128994257-128994279 ATGCATGAGTGAAGGAATGAAGG - Intronic
962517970 3:136171283-136171305 TATCATTTGTAAAGGAAGGAAGG + Intronic
963600119 3:147371682-147371704 CTTCCTTTGGAAAGGAAGGAAGG + Intergenic
964738724 3:159943417-159943439 CTGAATTAGCACAGAAAGGATGG - Intergenic
966211315 3:177456345-177456367 AAGAATTAGTAAAGGAATGAAGG + Intergenic
966227967 3:177618498-177618520 CTGCATCATGAAAGGAAGGTGGG - Intergenic
966918084 3:184595721-184595743 TAGCATCAGTAAAGGAAAGAGGG - Intronic
967593146 3:191301102-191301124 CTGGGTTAGTCAAGGAAAGAAGG - Intronic
967617600 3:191590861-191590883 TTGCAATTGTAAAAGAAGGATGG - Intergenic
967755392 3:193162764-193162786 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
969516464 4:7650942-7650964 CTGCATTTCTCAAGGGAGGATGG - Intronic
971833537 4:31731844-31731866 CAGTTTTAGAAAAGGAAGGAAGG - Intergenic
972051480 4:34740545-34740567 CTGCATTTGTGTAGGAAGGGTGG + Intergenic
972513706 4:39793521-39793543 CTCCGTCAGGAAAGGAAGGAAGG - Intergenic
973267973 4:48230349-48230371 CTTCATTTGTAAAGTATGGAAGG + Intronic
973892424 4:55380626-55380648 CTGCATAAGGACAGAAAGGAGGG - Intergenic
974345108 4:60669436-60669458 CTGAATTAGTAAGGTAAGAATGG + Intergenic
974647328 4:64712236-64712258 CTACAGTAGTAAAGTAATGATGG + Intergenic
974868888 4:67613977-67613999 CTGGATTTGGAAAGGAAGGAAGG - Exonic
975626684 4:76356864-76356886 CTGCATTAGTATGGGCAGCAAGG + Intronic
976585156 4:86789037-86789059 CTGCTTTAGCAGAGGAATGAAGG + Intronic
977061405 4:92261522-92261544 ATGCATGAGTGAATGAAGGATGG - Intergenic
977659809 4:99570798-99570820 CTGGATTTGTAAATGCAGGAAGG + Intronic
979047024 4:115880237-115880259 CTGCATTAGTAAAGATGGCATGG - Intergenic
980639074 4:135550654-135550676 CTGAATAAATAAAGGTAGGATGG - Intergenic
980984774 4:139684738-139684760 GTGCAGTAGTAAAGACAGGAAGG + Intronic
981398994 4:144289667-144289689 CTGCTTGACTAAAGGAAGAATGG + Intergenic
981417714 4:144512496-144512518 ATGCATCATTCAAGGAAGGATGG - Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
984055267 4:174920691-174920713 CTGGATGAATAAAGGAAAGAAGG + Exonic
984364530 4:178781445-178781467 CTGGATTTGGGAAGGAAGGAAGG + Intergenic
984393251 4:179165938-179165960 CTGGATTTGGAAAGAAAGGAAGG - Intergenic
984631650 4:182067101-182067123 CAGCAAATGTAAAGGAAGGATGG - Intergenic
985240187 4:187922929-187922951 ATGAATGAGTAAAGGAAGGAAGG - Intergenic
987031493 5:13980483-13980505 TTGCCTTAGCAATGGAAGGAGGG - Intergenic
988017311 5:25575633-25575655 CTGGATCTGTAAAGAAAGGAAGG - Intergenic
988365580 5:30294362-30294384 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
989993379 5:50796781-50796803 TTGCATTAGTAATGGTAGAAAGG + Intronic
990077195 5:51863187-51863209 CATCATTAGTAAATGAAGGAAGG - Intergenic
990186261 5:53213048-53213070 CTGGATATGGAAAGGAAGGAAGG + Intergenic
990330754 5:54723195-54723217 ATGCAAAAGGAAAGGAAGGAAGG + Intergenic
991234588 5:64379003-64379025 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
991964160 5:72074382-72074404 CTGAATAAGCAAGGGAAGGAAGG - Intergenic
993086814 5:83373205-83373227 CTGCATGAATAAAGCAAAGAAGG - Intergenic
993335477 5:86653023-86653045 CTGATTTAGTAAATGAATGATGG + Intergenic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
998066698 5:139165054-139165076 CTGGATCTGGAAAGGAAGGAAGG - Intronic
998546279 5:143030528-143030550 CTGTATTGATACAGGAAGGAAGG + Intronic
999227025 5:150034002-150034024 CTCCATTGGTAAAGTAAGGTGGG + Intronic
999376859 5:151092806-151092828 GTGCATCAGTAAAATAAGGAGGG - Intronic
999586250 5:153092838-153092860 CTGTATTAGAAAGGCAAGGAAGG + Intergenic
1000647100 5:163772210-163772232 CTGGATTCCTAAAGGAGGGAAGG + Intergenic
1000763416 5:165254814-165254836 CTGAAATAATAAAGGGAGGAAGG - Intergenic
1001128363 5:169041582-169041604 CTGCATTGGGGAAAGAAGGAAGG - Intronic
1001519014 5:172377457-172377479 CAGGATTTGAAAAGGAAGGAAGG - Intronic
1001943426 5:175757006-175757028 CTGCTCTGGTAAAGGAAGAAGGG - Intergenic
1002824079 6:756926-756948 CTGCATTTGGAGATGAAGGAAGG + Intergenic
1003231827 6:4260877-4260899 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1003688039 6:8323784-8323806 CTGCAAGAGTAAATGAAGGCAGG - Intergenic
1004200879 6:13546803-13546825 CTGAATTACAAAAGGGAGGAGGG - Intergenic
1004387497 6:15185305-15185327 CTCCATCAAGAAAGGAAGGAAGG + Intergenic
1004693932 6:18016521-18016543 CTTCTTGAGTAAAGGCAGGAAGG - Intergenic
1005134852 6:22556318-22556340 CTGCTGGAGTAGAGGAAGGATGG - Intergenic
1005198483 6:23316219-23316241 CAGCATGAGCAAAGGAATGAGGG + Intergenic
1005703867 6:28431143-28431165 TTGGATTAGGAAAGAAAGGATGG - Intergenic
1007842002 6:44724038-44724060 CTGCCTTAGTACAGGAATCACGG - Intergenic
1008455981 6:51711275-51711297 CTGCATTAGTGAAACAAAGAAGG - Intronic
1008612570 6:53197743-53197765 CTGGGATACTAAAGGAAGGAAGG + Intergenic
1008780446 6:55097044-55097066 CTATATTAGTAAAAGAAGAAAGG - Intergenic
1009320953 6:62287167-62287189 CCGCATTGGTAAAAGAAGGATGG - Intergenic
1010640742 6:78323556-78323578 CTTCTTCAGTAAATGAAGGAAGG + Intergenic
1011188971 6:84710832-84710854 CTGGATTACTAAAGGATAGAGGG - Intronic
1011896605 6:92235354-92235376 CTGCCTTAATATAGGAAAGAAGG - Intergenic
1012624460 6:101390157-101390179 CTTGATTAGTCAAGAAAGGATGG - Intergenic
1013545110 6:111148935-111148957 CAGCATAAGTAAAGGAGAGATGG - Intronic
1013639464 6:112059089-112059111 TTGGACTAGGAAAGGAAGGAGGG + Intronic
1014171963 6:118288670-118288692 CTGAATTCCAAAAGGAAGGAGGG + Intronic
1014801477 6:125783015-125783037 CTGCCTTTGAAAAGGGAGGAAGG + Intronic
1017337121 6:153274302-153274324 CTGCAGTAGTAAACAAAGTATGG - Intergenic
1017815392 6:158012456-158012478 CTGAATTTGAAGAGGAAGGAAGG + Intronic
1017967892 6:159282186-159282208 CTGCTGTGTTAAAGGAAGGATGG - Intergenic
1018136876 6:160787626-160787648 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1018247487 6:161836760-161836782 ATGCTTTAGTAGAGGAAGGGAGG - Intronic
1018377651 6:163228635-163228657 CTGCAGAAGTAAAGGAACGATGG + Intronic
1018517817 6:164606209-164606231 CTGGATTAGAAGATGAAGGAAGG + Intergenic
1019107322 6:169678867-169678889 CTGGATCTGGAAAGGAAGGAAGG - Intronic
1021075163 7:16294528-16294550 TTGAATTAGTAAAAGCAGGAAGG - Intronic
1021811594 7:24407055-24407077 CTGCATTCCTAGAGGAATGAAGG + Intergenic
1022514647 7:30967713-30967735 CTGCATAAAAAAAGGAAGGAGGG - Intronic
1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG + Intronic
1026476486 7:70740394-70740416 CTGAAGCAGCAAAGGAAGGAAGG - Intronic
1026870585 7:73848843-73848865 CTCCATCAAGAAAGGAAGGAAGG - Intergenic
1029599577 7:101555912-101555934 CAGCATTGGGAGAGGAAGGAGGG - Intronic
1030118074 7:106078816-106078838 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1031083474 7:117280126-117280148 CTTCATGAGGACAGGAAGGATGG + Intronic
1031152625 7:118072286-118072308 TTGCATGAGTACAGAAAGGATGG - Intergenic
1032552167 7:132794215-132794237 CTGCATTAGTGGATGATGGATGG + Intronic
1033627736 7:143127524-143127546 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034876847 7:154732386-154732408 CTGCTTTGGTAAAAGAAGTATGG - Intronic
1035346272 7:158201559-158201581 CTGGATCTGGAAAGGAAGGAAGG - Intronic
1036479308 8:9124098-9124120 CTGAATTAGGAAAGAGAGGAAGG + Intergenic
1038079054 8:24111580-24111602 CTGCATTAGGAAAAGGGGGAGGG - Intergenic
1040417581 8:47208732-47208754 CTGAATTCCAAAAGGAAGGAAGG - Intergenic
1040614945 8:49025727-49025749 CTGCATGCAGAAAGGAAGGATGG + Intergenic
1040664599 8:49618103-49618125 CTGGATTTGGAAAGGAAGGAAGG - Intergenic
1040986028 8:53295198-53295220 CCTCAGTGGTAAAGGAAGGAAGG + Intergenic
1042033882 8:64508615-64508637 CTCCAGTACCAAAGGAAGGAAGG - Intergenic
1042773269 8:72401951-72401973 CAGAATTAGGAAAGGAAGGAGGG + Intergenic
1042794484 8:72645835-72645857 CTTCATTAGTAAATGACAGATGG + Intronic
1043768377 8:84165372-84165394 CTGATTTAGTAAGGGAAAGATGG - Intergenic
1043939038 8:86175438-86175460 CTGTATTATTATTGGAAGGATGG - Intergenic
1045557041 8:103224666-103224688 CTGGATCTGGAAAGGAAGGAAGG + Intronic
1046623091 8:116548390-116548412 CTGCTTTAGAACAGGAAGTAAGG - Intergenic
1046766298 8:118073928-118073950 CTTCATTAGAGAAGGGAGGAGGG + Intronic
1046829583 8:118729858-118729880 GTGCATGAGATAAGGAAGGAAGG - Intergenic
1047055157 8:121155730-121155752 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
1047661018 8:127036867-127036889 ATTCATTAATACAGGAAGGAAGG - Intergenic
1047958954 8:129997028-129997050 ATGCCTTTGTGAAGGAAGGAAGG + Intronic
1048016450 8:130501590-130501612 CTGCATTAGGAAAGGCGGGGTGG + Intergenic
1048053871 8:130845830-130845852 TTGAATTAATAAAAGAAGGAAGG + Intronic
1048090128 8:131231518-131231540 TTCCATTCGTCAAGGAAGGAGGG + Intergenic
1048169479 8:132092192-132092214 CTGTCTTACTAAAGGAAGGTGGG - Intronic
1048185076 8:132232719-132232741 CTTCATTAGTAAAGGAGAAAAGG - Intronic
1050044603 9:1529747-1529769 CTGCAATAGTAAAGGCAGGTGGG + Intergenic
1050621334 9:7454974-7454996 CTGCATTTGTAAGGGAGGCAGGG + Intergenic
1051327274 9:15986440-15986462 CTGCATTAGTAAAGTAAGTTCGG - Intronic
1052036511 9:23687356-23687378 CTGCATCAGTAAGGGTAGGTGGG - Intergenic
1052412013 9:28133857-28133879 GGGCATTAGTAAATGATGGATGG - Intronic
1052668905 9:31530150-31530172 CTGCATTATGAAAAGATGGAAGG - Intergenic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1054840372 9:69731904-69731926 GTGCATTGGTAAAGCAAGGCAGG - Intronic
1055027362 9:71736353-71736375 CTGCATCAGTGAAGGTAGCAGGG + Intronic
1056075844 9:83039374-83039396 CTCCATTAATGAATGAAGGAAGG + Intronic
1056600020 9:88039610-88039632 CTGCATTCGTTAAGGAACAAGGG + Intergenic
1056642159 9:88380809-88380831 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1056837888 9:89972294-89972316 CTGGATTAGGAAAGAAGGGAGGG - Intergenic
1057077661 9:92147357-92147379 TTACATCAGTAAAGGAAGGAAGG - Intergenic
1061359066 9:130129560-130129582 CGGCAACAGTAAAGGAAGGCAGG + Intronic
1061742652 9:132718320-132718342 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1062180385 9:135188160-135188182 CTGCATTTCAAAAGGAAAGATGG - Intergenic
1062258527 9:135644097-135644119 CTGGATCTGGAAAGGAAGGAAGG + Intergenic
1187771835 X:22707248-22707270 ATGCTTGAGTAAAGGATGGAAGG + Intergenic
1187789822 X:22937943-22937965 CTCCATTGAGAAAGGAAGGAAGG - Intergenic
1187893339 X:23957679-23957701 GTGTTTTAGTAAAGGCAGGAAGG - Intergenic
1188439610 X:30202451-30202473 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1188501338 X:30830264-30830286 CTGCATTATTTAGGAAAGGAGGG - Exonic
1190011663 X:46790537-46790559 CTGCAATGGAAAGGGAAGGATGG + Intergenic
1190371930 X:49751006-49751028 CTGGATCTGGAAAGGAAGGAAGG + Intergenic
1190408244 X:50109190-50109212 CTGAATTCCAAAAGGAAGGAGGG - Intergenic
1191638219 X:63401212-63401234 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1194087431 X:89546195-89546217 CTGTAATAGTGAAGGAAGCAGGG - Intergenic
1194138837 X:90182193-90182215 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1194289255 X:92049168-92049190 CTGGATCTGGAAAGGAAGGAAGG + Intronic
1199171453 X:144739031-144739053 CTGGATTTGTAAAGAAAGGAAGG - Intergenic
1200440078 Y:3202067-3202089 CTGTAATAGTGAAGGAAGCAGGG - Intergenic
1200484640 Y:3752426-3752448 CTGGATCTGGAAAGGAAGGAAGG - Intergenic
1200606771 Y:5273742-5273764 CTGGATCTGGAAAGGAAGGAAGG + Intronic
1201940144 Y:19450298-19450320 CTGCATTTGTTAAGGAACAAGGG - Intergenic