ID: 1125182962

View in Genome Browser
Species Human (GRCh38)
Location 15:36898181-36898203
Sequence GCAACATTTCAGGTGACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125182962 Original CRISPR GCAACATTTCAGGTGACAGG TGG (reversed) Intronic
900785967 1:4650763-4650785 GAAACAGCTCAGGTGCCAGGGGG + Intergenic
902593903 1:17494939-17494961 GCAACATGGCAGGTGAAAGTTGG - Intergenic
902774999 1:18669026-18669048 GCAACATGTCAGGGCCCAGGAGG + Intronic
904892923 1:33792866-33792888 GCAACTTTTCAGGCCACATGTGG + Intronic
907872767 1:58457773-58457795 ACTAGATTTCAGGTGACTGGGGG - Intronic
908364015 1:63399009-63399031 GCTATATTTCAGGTGTCAGCTGG + Intronic
908941338 1:69438156-69438178 TCAACATTTCAGGTGACACCTGG - Intergenic
909314318 1:74196802-74196824 GCAATATTGCAGGTGAGAGCTGG - Intronic
910173185 1:84399943-84399965 GCAGCATTACAGGTGAGAAGAGG + Intronic
910444801 1:87289224-87289246 GCCACATTTCAAGTGACCAGTGG + Intergenic
911459559 1:98172397-98172419 GTAAGATTTCAGGTGACTGGGGG - Intergenic
911882994 1:103265490-103265512 TCAACATTTAAGATGTCAGGAGG - Intergenic
916474015 1:165151132-165151154 GAAATGTTTCAGGTGAAAGGAGG - Intergenic
917911966 1:179657957-179657979 ACAAAATTTCAGTAGACAGGAGG - Intronic
918963008 1:191305064-191305086 GCCACATTTCATGTGATAGTTGG + Intergenic
1072677112 10:97475894-97475916 GATTCATTTCAGGAGACAGGTGG + Intronic
1073117789 10:101101817-101101839 GCCACATTCCAGGTGAAAGGTGG + Intronic
1073157425 10:101358744-101358766 GGGACATTCCAGGAGACAGGAGG + Intronic
1075182492 10:120224613-120224635 GCAACATTACCGCAGACAGGAGG + Intergenic
1077771609 11:5225075-5225097 GGAACACTTCAGGGGAAAGGTGG + Intergenic
1081779956 11:45703383-45703405 GCAACATTTCCAGAGGCAGGTGG + Intergenic
1082012588 11:47460250-47460272 GCCACATTTCAAGTGACTGGTGG - Intergenic
1084206982 11:67600956-67600978 GCAAGACTTCAGGTGACAACAGG + Intergenic
1085120782 11:73966110-73966132 GCAACATATCAGGTGTGGGGAGG - Intronic
1085350343 11:75794191-75794213 GCAAATCTTCAGGTGACAGAGGG - Intronic
1085597198 11:77820784-77820806 GCAACCTTACAGACGACAGGAGG + Exonic
1085849067 11:80098820-80098842 GCAACATTCCAAATGAGAGGAGG - Intergenic
1088749642 11:112832779-112832801 GGAACATGCCAGGTGACAGTAGG - Intergenic
1093713120 12:22350472-22350494 GCAACAGCTCATCTGACAGGAGG - Intronic
1093810806 12:23490270-23490292 GCCACAATTGATGTGACAGGAGG - Intergenic
1094473569 12:30824520-30824542 GGGACATTTCAGCTGACATGAGG - Intergenic
1098356276 12:69615997-69616019 AGAAGATTTCAGGTGACAGCTGG + Intergenic
1104573243 12:129943924-129943946 GCAGCATTTCACGTGGCTGGTGG + Intergenic
1104611141 12:130228740-130228762 GCAGCATTGCAGGTGCCAGGAGG - Intergenic
1105223594 13:18357489-18357511 GCATTGTTTCAGGTGAAAGGTGG + Intergenic
1105523516 13:21153044-21153066 GCTACAATTCAGGTGACATTTGG - Intergenic
1111097225 13:83532837-83532859 GCAACATTTGGAGTGACAGTCGG - Intergenic
1111896286 13:94145903-94145925 GCAACTGGACAGGTGACAGGAGG + Intronic
1113678836 13:112227805-112227827 ACAGTATTTCAGGTGACTGGAGG - Intergenic
1114480215 14:23028954-23028976 GCAGAATTTCAGAAGACAGGAGG - Intronic
1115530003 14:34318293-34318315 GCTACATATCAAGTGCCAGGGGG + Intronic
1119032006 14:71200115-71200137 GCATCATTCCATGTGCCAGGTGG + Intergenic
1119645147 14:76342475-76342497 GCATCATGACAGGTGTCAGGTGG - Intronic
1124459247 15:29874028-29874050 GGTACATTTCAGGCGAGAGGAGG - Intronic
1125133642 15:36314358-36314380 GGAACATTGCAGATGACTGGAGG - Intergenic
1125182962 15:36898181-36898203 GCAACATTTCAGGTGACAGGTGG - Intronic
1126508179 15:49432849-49432871 GCATCATTTCTTGTTACAGGAGG - Intronic
1127783014 15:62332675-62332697 GCCACATTTCAGGCGATGGGCGG + Intergenic
1131854579 15:96579770-96579792 GCAATAATCCAGGTGACAGATGG + Intergenic
1136172627 16:28497861-28497883 GGAACATGTCAGGGGCCAGGAGG + Exonic
1138094934 16:54204131-54204153 TCAACTCTTCAGGGGACAGGTGG + Intergenic
1140073018 16:71669395-71669417 GCACCATTTAAGATGACAAGTGG + Intronic
1141376468 16:83535445-83535467 GCAATAGTTCTGGTGAGAGGTGG + Intronic
1142811998 17:2399800-2399822 GCAACATTCCAGGCGAGAGCGGG + Intronic
1143520785 17:7443132-7443154 ACTACATTTCAGGGGGCAGGGGG - Exonic
1145791497 17:27630461-27630483 AGAACATTTCAAGTGACATGGGG - Exonic
1146421584 17:32691371-32691393 GCAACATTTCTCATGACAGTGGG - Intronic
1147413787 17:40273804-40273826 GCACCATTTCGGATCACAGGTGG - Exonic
1148775234 17:50091528-50091550 GCCACATTCCAGGTCACAGGGGG - Intergenic
1149456303 17:56791310-56791332 GCAACATTTCTTGTGAAAAGTGG - Intergenic
1150220919 17:63495452-63495474 GCATCATCCCAGGTGCCAGGAGG - Intronic
1151976922 17:77488429-77488451 GCAGCATGTCAGGTCCCAGGAGG - Intronic
1152049709 17:77962944-77962966 GCAAAATATCAGGTGAGAAGTGG + Intergenic
1152465876 17:80465921-80465943 ACACCATCCCAGGTGACAGGTGG + Intergenic
1153165793 18:2261024-2261046 GGTACAATTTAGGTGACAGGAGG - Intergenic
1157273704 18:46295183-46295205 GTAGCATTTCAGGGTACAGGAGG - Intergenic
1158566665 18:58559996-58560018 GCTACAATTAAGGTGTCAGGAGG + Intronic
1167306501 19:48713119-48713141 GCAGCACTTCAGGAGGCAGGTGG + Exonic
925467666 2:4123441-4123463 GTAAAATTTCAGGAGGCAGGAGG - Intergenic
927274505 2:21251076-21251098 GTAAGATTCCAGTTGACAGGTGG + Intergenic
928056184 2:28057564-28057586 ACAACCTGTCAGGTGCCAGGTGG - Intronic
930920330 2:56745559-56745581 CCAACATTTCAAGTCACTGGGGG - Intergenic
931218441 2:60267333-60267355 GCAGCACTCCAGGTGACATGTGG + Intergenic
931490808 2:62744790-62744812 GCAACAGTTCAGGTGGCACTAGG + Intronic
933290578 2:80433756-80433778 GAAAGGTTTCTGGTGACAGGAGG - Intronic
934516288 2:94989258-94989280 GCAACAGGTCAGCTGACAGCTGG + Intergenic
937460003 2:122077425-122077447 GCAAGTCTTCAGGGGACAGGAGG - Intergenic
941626164 2:167832921-167832943 GCACCATTAGAGGTGACAGCAGG + Intergenic
942685885 2:178531514-178531536 GCAACGTTGGACGTGACAGGAGG - Exonic
944515290 2:200507021-200507043 GCAAAAATTCAGGTGCCTGGGGG - Exonic
947489331 2:230580392-230580414 GCTACCTTTCAGGTGCCAGATGG - Intergenic
948223526 2:236291476-236291498 GCAACAGTTCAGGTGAGAGTTGG + Intergenic
948657272 2:239484389-239484411 GCAGCAACTGAGGTGACAGGAGG + Intergenic
948665161 2:239529992-239530014 GCATCTCTGCAGGTGACAGGTGG - Intergenic
1172206266 20:33164880-33164902 GGAACATTCCATGGGACAGGAGG + Intronic
1172866688 20:38105259-38105281 GCAACAAATCAGGAGGCAGGAGG - Intronic
1173497850 20:43532152-43532174 GCAAGTTCCCAGGTGACAGGTGG + Intronic
1173860675 20:46281272-46281294 TGAACAGTTCAGGTGACAGATGG + Intronic
1176732137 21:10509870-10509892 GCATTGTTTCAGGTGAAAGGTGG + Intergenic
1178679983 21:34665881-34665903 GCAATAATCTAGGTGACAGGAGG + Intergenic
1182276754 22:29194657-29194679 GAAGCATTTCAGGTGACAGTTGG + Intergenic
1182413022 22:30203011-30203033 TCAACCTTCCAGGTGAGAGGAGG + Intergenic
1185396139 22:50590034-50590056 TAAACATTTCAGGAAACAGGAGG - Intronic
950495797 3:13333595-13333617 GCTCCATATGAGGTGACAGGAGG + Intronic
952622959 3:35368043-35368065 GCATCCTTGCAGGTGGCAGGCGG - Intergenic
953677958 3:45017980-45018002 GCCACATTTCTGTTGACATGGGG + Intronic
954819623 3:53314543-53314565 GCAACATGTCAGGAGGTAGGTGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
959858347 3:111188135-111188157 GCAACATTTCAGGTGGTCTGTGG + Intronic
961828589 3:129611841-129611863 GGAACACTTCAGGGGCCAGGAGG - Intergenic
964087721 3:152836692-152836714 GCCACGTATCAGGTGACAAGAGG + Exonic
967347326 3:188472315-188472337 GCAATATTTCAGCTAGCAGGTGG + Intronic
967994052 3:195153432-195153454 GAAACATTTCAGCTGAGGGGTGG + Intronic
970326582 4:14931168-14931190 GCAACATTTCTTGTGAGATGTGG - Intergenic
975454961 4:74579234-74579256 GCTAAAATTCAGGTGTCAGGAGG + Intergenic
975839586 4:78459421-78459443 GCAACATGGCAGAGGACAGGGGG + Intronic
976979867 4:91214095-91214117 GCAATCTTTTTGGTGACAGGAGG - Intronic
979700591 4:123662698-123662720 GCAACAATTCAGTTGATAAGAGG - Intergenic
980267262 4:130533420-130533442 GCAACATTTCAGGAGAGATTAGG + Intergenic
980290238 4:130840630-130840652 GACACATTTCAGGGGAGAGGAGG + Intergenic
981527436 4:145720500-145720522 GCAACAGCTCAGCCGACAGGTGG - Intronic
982120540 4:152138911-152138933 GCAAGAGTTCAGGTGGCTGGAGG - Intergenic
982295490 4:153823878-153823900 GAGACATTTCAGATGACATGTGG + Intergenic
985101438 4:186462358-186462380 GCCTCATTTCAGGGGACGGGTGG - Intronic
987085404 5:14463002-14463024 GCCTCATTTCAGGAGACAGGAGG + Intronic
987481891 5:18469396-18469418 AAAACATTTCAGGTGACAAAGGG - Intergenic
992188817 5:74270020-74270042 GCAACTTTGGAGGTGTCAGGGGG - Intergenic
992625506 5:78633001-78633023 GAAGCATTTCAGGTCACAAGAGG + Intronic
1007295149 6:40815694-40815716 GCAACATTGTAGGAAACAGGTGG + Intergenic
1010341195 6:74755120-74755142 GCCACCTTTCAGGCGACAAGAGG + Intergenic
1015471565 6:133612193-133612215 ACAACAATTCAGGTGTGAGGTGG - Intergenic
1017216904 6:151918629-151918651 GCAACAATTCAGTTAACTGGTGG + Intronic
1019531618 7:1506335-1506357 GCTCCCATTCAGGTGACAGGAGG - Intergenic
1021934617 7:25617537-25617559 TAAACATGTCAGGTGACATGTGG - Intergenic
1031258929 7:119491734-119491756 GCAACAATTCCAGTGACAGATGG + Intergenic
1032941302 7:136795808-136795830 GCATCATTTCTGGGCACAGGTGG + Intergenic
1033460119 7:141539316-141539338 GCCACCTTTCAGCTGAGAGGAGG + Intergenic
1033518813 7:142139075-142139097 GCAACACTGGAGGTGACATGAGG + Intronic
1034597446 7:152211534-152211556 GCATTGTTTCAGGTGAAAGGTGG - Intronic
1034933859 7:155185680-155185702 GCAGCTTTTCAGGAGACAGATGG - Intergenic
1036082204 8:5568935-5568957 GCAACATTTCAGGGAAGAGATGG + Intergenic
1036570648 8:9977239-9977261 CCAAAATTTCAGGCTACAGGTGG + Intergenic
1037327957 8:17713353-17713375 GCTACATTTCAGGTTCCCGGTGG + Intronic
1039457267 8:37715809-37715831 GCATCATTTCAGCTGCCATGGGG - Intergenic
1041179945 8:55236752-55236774 GCAATATTTCAGGTGAGATGTGG - Intronic
1041904827 8:63020925-63020947 GCAGCAATCCAGGTGGCAGGTGG + Intronic
1046145822 8:110157007-110157029 GCAACATTTCCTGTGACCAGTGG + Intergenic
1046958907 8:120089157-120089179 GCCACAGTGCAGGTGTCAGGAGG + Intronic
1047389323 8:124437360-124437382 GCAAAATCTCAGGTATCAGGAGG + Intergenic
1053399252 9:37802521-37802543 GCAGCATATCATGTTACAGGAGG + Intronic
1055202222 9:73679574-73679596 ACAAAATTACAGGTGACAAGAGG + Intergenic
1057039610 9:91838406-91838428 GGAATGTTTCAGGTGCCAGGAGG - Intronic
1061760284 9:132846632-132846654 GGAACATATCAGGTGGCATGGGG + Intronic
1062475860 9:136726962-136726984 GCAACATCTTAAGTGACTGGAGG - Intergenic
1187206430 X:17186044-17186066 GAAACAGTTCAGGTGTGAGGAGG - Intergenic
1187279363 X:17846228-17846250 GCAACATTTCCCCTGGCAGGTGG + Intronic
1195461876 X:105136659-105136681 TCAATATTTTAGTTGACAGGAGG + Intronic
1197896617 X:131322369-131322391 GCAGAATTTGTGGTGACAGGTGG - Intronic
1198219788 X:134588823-134588845 GCAACAGCTCCGGTGTCAGGTGG + Intronic
1200684675 Y:6247662-6247684 TGAACATCACAGGTGACAGGTGG + Exonic
1200990205 Y:9338927-9338949 TGAACATCACAGGTGACAGGTGG + Exonic
1200992867 Y:9359242-9359264 TGAACATCACAGGTGACAGGTGG + Exonic
1200995520 Y:9379520-9379542 TGAACATCACAGGTGACAGGTGG + Intronic
1200998186 Y:9399866-9399888 TGAACATCACAGGTGACAGGTGG + Exonic
1201000695 Y:9468400-9468422 TGAACATCACAGGTGACAGGTGG + Intronic
1201003361 Y:9488730-9488752 TGAACATCACAGGTGACAGGTGG + Exonic
1201006017 Y:9509012-9509034 TGAACATCACAGGTGACAGGTGG + Intergenic
1201008675 Y:9529325-9529347 TGAACATCACAGGTGACAGGTGG + Exonic
1201011252 Y:9549494-9549516 TGAACATCACAGGTGACAGGTGG + Intergenic