ID: 1125183680

View in Genome Browser
Species Human (GRCh38)
Location 15:36906817-36906839
Sequence CAGGATAATTTGGAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125183680_1125183686 13 Left 1125183680 15:36906817-36906839 CCTTCCTCTTCCAAATTATCCTG 0: 1
1: 0
2: 2
3: 21
4: 334
Right 1125183686 15:36906853-36906875 GTTCTTTATCTGACCATGACTGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125183680 Original CRISPR CAGGATAATTTGGAAGAGGA AGG (reversed) Intronic
902097852 1:13961132-13961154 CATTATAAGTTGGAAGAAGAGGG - Intergenic
902353866 1:15881406-15881428 AAGGAAAATTTGGAACAGGTGGG + Intronic
903477480 1:23629517-23629539 CAGGATAATATAGCAGAGGATGG - Exonic
904304846 1:29581817-29581839 CTGGATTATTTTTAAGAGGAAGG - Intergenic
904776649 1:32912752-32912774 CAGGATAATTTAATAGAGAATGG - Intergenic
904969893 1:34411265-34411287 CAGGATGATTTGGGGGAGCAGGG - Intergenic
906419344 1:45651190-45651212 CAGGTTAACTTGGAAGACAAAGG - Intronic
906651753 1:47517688-47517710 CAGGAGAGTTTGGAAAATGATGG + Intergenic
907667329 1:56444881-56444903 CAGTATAAATTGCAACAGGAAGG + Intergenic
907860921 1:58352229-58352251 CAGGTTAATTTAGAGGAGGCAGG - Intronic
908680233 1:66652630-66652652 CAGGCTAATTTGGGGGTGGAAGG - Intronic
912954846 1:114148113-114148135 CAGCATTTTCTGGAAGAGGAGGG - Intronic
915110455 1:153561572-153561594 CAGGAGAAAGTGGATGAGGAGGG - Exonic
916383936 1:164245864-164245886 CAGAGTAACTTGGGAGAGGAGGG + Intergenic
916695200 1:167228289-167228311 CAGGATGGTTTGAAATAGGAAGG + Intronic
916744755 1:167676605-167676627 CAGTGTAATTTGGGAGATGATGG - Intronic
916825648 1:168439442-168439464 AAGGATAATGTGGAAGAGAGAGG + Intergenic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
918565037 1:185919128-185919150 TAACATAATTTGGAAGAGAAGGG + Intronic
919366348 1:196666109-196666131 CAGGATAATTTTGCTGATGAAGG + Intronic
921306459 1:213801843-213801865 CAGGAATATTGGGAAGAGAATGG + Intergenic
921847866 1:219903274-219903296 GAGGGTAATTTGGAAGAACAGGG - Intronic
923206998 1:231768817-231768839 TAAGATGATGTGGAAGAGGATGG + Intronic
923830318 1:237548637-237548659 TAGCATAATTTGTAACAGGAAGG + Intronic
1063766717 10:9150000-9150022 AATGATAATTTGTAACAGGAAGG + Intergenic
1063857408 10:10270921-10270943 AAGGATTATTTAGAAGAAGAAGG + Intergenic
1064325205 10:14343910-14343932 CAGGAAAAACTGGAAGAGGAAGG - Intronic
1064614543 10:17139182-17139204 TAGGTTGATTTGGAACAGGATGG - Intergenic
1066416212 10:35223980-35224002 TGGGAGAATTTAGAAGAGGAAGG - Intergenic
1067914590 10:50383504-50383526 CAGGAAAGTTTGGAAAAGGTGGG + Intronic
1068092340 10:52448110-52448132 CAGGATATCTGGGAAGAAGAGGG - Intergenic
1068471885 10:57476018-57476040 TAGGATGAATTTGAAGAGGATGG - Intergenic
1069078126 10:64059801-64059823 TAAGATATATTGGAAGAGGATGG + Intergenic
1069948504 10:72003366-72003388 CAGGAAAATTAGGAAGAGGCAGG + Intronic
1070661820 10:78312169-78312191 CAGGACAGATTGAAAGAGGAGGG + Intergenic
1071734070 10:88278695-88278717 CATTATATTTTGGAAGAGGTTGG - Intronic
1071925684 10:90406445-90406467 CAGGAAAATTGGTAAGAGGTGGG - Intergenic
1072856127 10:98948761-98948783 GAGGAGGATGTGGAAGAGGAGGG - Intronic
1074348518 10:112712139-112712161 CAGGATATATCTGAAGAGGATGG - Intronic
1074969454 10:118523814-118523836 CTGGATAAATTGGAGGAGTATGG - Intergenic
1075641200 10:124065685-124065707 AAAGCTAATTTGGAAGAGGCAGG - Intronic
1075755927 10:124811302-124811324 AAGCATAATCTGGAAGATGAAGG + Intronic
1078034077 11:7784222-7784244 CAGGTTAACTTGGAAGACAAAGG + Intergenic
1078199486 11:9167355-9167377 CAGAATATTTTGGAGGAGGGTGG - Intronic
1083106478 11:60363210-60363232 CAGGGAAAGATGGAAGAGGAAGG - Intronic
1083249517 11:61456706-61456728 CAGAATGACTGGGAAGAGGACGG - Intronic
1085363586 11:75916120-75916142 CAGGATATTTCTGAAGAAGAAGG - Intronic
1085366029 11:75945716-75945738 CAGGGTCATATGGGAGAGGATGG - Intronic
1085408701 11:76279016-76279038 CAGCATTATGTGGAAGAGGCGGG - Intergenic
1086238589 11:84662074-84662096 CATGATAATATGGAAGTAGAGGG + Intronic
1086507813 11:87524233-87524255 AAGGATAATTTGGCAGGGAAGGG - Intergenic
1087541802 11:99531059-99531081 CAGGAAAATGTGGAAGAGTTTGG + Intronic
1088551470 11:111017705-111017727 CAGCACAATTTGGCTGAGGATGG - Intergenic
1088659436 11:112030751-112030773 CAGAATTATTTAGAAAAGGACGG - Intronic
1088759705 11:112917804-112917826 CAGGATCATTTGGCATGGGATGG + Intergenic
1088809069 11:113377725-113377747 CAGGATGATCTAGAAGAGAAAGG - Intronic
1089022459 11:115230495-115230517 CAGGGTAACTTTGAAAAGGAAGG + Intronic
1090094676 11:123730839-123730861 CAGGATCTTTGGGAAGAAGAGGG - Exonic
1090169147 11:124582854-124582876 GAGTATGATGTGGAAGAGGAAGG - Intergenic
1091568765 12:1666303-1666325 TAGGATAATTTTGTAGAGGCGGG - Intergenic
1092020190 12:5195740-5195762 GATGATAATATTGAAGAGGAAGG - Intergenic
1092874001 12:12832527-12832549 AAGGATAATTTAGAGGAGGTAGG + Intergenic
1092879417 12:12876338-12876360 AAGGATAATTTGGCAGATGAGGG - Intergenic
1094228948 12:28080800-28080822 CAGGATAATTTGTAAGGAAAAGG - Intergenic
1095274093 12:40259031-40259053 GATGTTAATCTGGAAGAGGAAGG + Intronic
1096265698 12:50120822-50120844 GAGGATAGTTCGCAAGAGGAAGG + Intergenic
1097415425 12:59310364-59310386 CAGGTTTAATTGGAAGAGGAAGG - Intergenic
1097691610 12:62739384-62739406 CAGGAGAATTTGAAAGGGGGCGG + Intronic
1098101875 12:67026608-67026630 CAGGATAATGAAGAAGAGGAAGG - Intergenic
1098131479 12:67355115-67355137 CAGGATGTTTGGGCAGAGGAGGG + Intergenic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098834044 12:75399128-75399150 CAGGATATTTTGAAAAATGAGGG + Intronic
1099160774 12:79239010-79239032 TAGGATAATTTGGAAGAATAAGG - Intronic
1099270708 12:80506380-80506402 TAGGATAATGTGGAAAAGGATGG - Intronic
1099558767 12:84146859-84146881 CAGGATAATTAATGAGAGGAGGG + Intergenic
1100348758 12:93757973-93757995 CAGCATACATTGGAAGAAGAGGG + Intronic
1101129386 12:101673049-101673071 CAGGATAATTGTTAAGAGCATGG - Intronic
1101336019 12:103797597-103797619 CAGGAGAAATTGGGAGGGGAAGG - Intronic
1101619672 12:106372768-106372790 AAGGAAAAATTGGAAGACGAAGG - Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102448585 12:113023322-113023344 AAAGATAGTTTGGAAGATGAAGG - Intergenic
1103774200 12:123353653-123353675 TAGGATAATTTGTAAAAGTATGG - Intronic
1104483104 12:129125942-129125964 CAGGAAAATTAGGAAAAGAAAGG - Intronic
1106683283 13:32030594-32030616 CAGGTTATGTTGGAAGAGGTGGG - Intergenic
1106928347 13:34636421-34636443 CAAGATACTTTGGAGGTGGATGG - Intergenic
1107109573 13:36681878-36681900 CAGGATAATTGAGGAAAGGATGG - Intronic
1108719735 13:53118625-53118647 CAGGAAAATGTGGGAGAGTATGG - Intergenic
1108944471 13:56003676-56003698 CAGGATAATGTGGAAAAGTTTGG - Intergenic
1109219513 13:59627168-59627190 CAGGAGTCTTTGCAAGAGGAAGG - Intergenic
1109859467 13:68178822-68178844 CAGGAAAATGTGGGAGAGGTTGG + Intergenic
1110331677 13:74280078-74280100 CAGGATAAATTTTAAAAGGAAGG - Intergenic
1111241293 13:85479027-85479049 CAGGATAATGAGGCAAAGGATGG - Intergenic
1112481157 13:99776676-99776698 CAGGGAAATTTTGAAGAGGTTGG + Intronic
1112571441 13:100597136-100597158 AAGAATAATCTAGAAGAGGAAGG + Intergenic
1114414524 14:22532220-22532242 CAAGACACTTTGGCAGAGGATGG - Intergenic
1114439141 14:22732239-22732261 CAGTCTAATTTGGAAAAGGGTGG - Intergenic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1121080601 14:91104730-91104752 CAGGCCAATTTGGAAGACAAAGG - Intronic
1121772547 14:96561342-96561364 CTGGATAATTTGGGAGAAGGGGG - Intronic
1123983544 15:25624391-25624413 TAGTATAATTTTGCAGAGGAAGG + Intergenic
1124646311 15:31439822-31439844 CAGGAATATTTGATAGAGGAGGG - Intergenic
1125183680 15:36906817-36906839 CAGGATAATTTGGAAGAGGAAGG - Intronic
1125770356 15:42161164-42161186 CAGGCTAATTCTGAAAAGGACGG + Intronic
1125956398 15:43793611-43793633 AAGGATAAGATGGAAGTGGATGG - Exonic
1126616201 15:50583404-50583426 CAGGGTGATTGGGAACAGGAGGG - Intronic
1127296664 15:57614655-57614677 CAGGGCCATTTGGAAGAGGCAGG - Intronic
1128367639 15:67015691-67015713 GAAGATAATTTGGAGGAGAAAGG + Intergenic
1129324293 15:74791933-74791955 CAGGCTAATTGGAAACAGGAAGG - Intronic
1131780542 15:95852578-95852600 CAGTATAATATTGAACAGGAGGG - Intergenic
1132309429 15:100846256-100846278 CAGCTTGATGTGGAAGAGGAAGG + Intergenic
1132949797 16:2554772-2554794 CAGGACTATTTGGATGAGGGTGG - Intronic
1132964551 16:2645395-2645417 CAGGACTATTTGGATGAGGGTGG + Intergenic
1133855043 16:9541702-9541724 CAGGAAACTTGGGAAGGGGAAGG + Intergenic
1135513545 16:23110283-23110305 GAGGCTAATTAAGAAGAGGACGG + Intronic
1137014162 16:35357459-35357481 CAGGAAAATATAGAAGGGGACGG + Intergenic
1137569596 16:49557024-49557046 CCCAATTATTTGGAAGAGGAGGG - Intronic
1137865698 16:51893717-51893739 TAGGATAATGTGGATGAGGAAGG + Intergenic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1139344270 16:66292486-66292508 CAGGATGATTGAGAGGAGGAGGG - Intergenic
1141355172 16:83338803-83338825 CTGGATAATAAGGAAGAAGAGGG + Intronic
1143515439 17:7417345-7417367 CAGGATGTTGAGGAAGAGGAGGG - Exonic
1143772641 17:9178457-9178479 GAGGAGAATTAGGAAGAGGAGGG - Intronic
1144302571 17:13935673-13935695 AAGGATAATCTCAAAGAGGAAGG + Intergenic
1145686832 17:26677543-26677565 CAGGGTAATTAGGAAGGAGAAGG + Intergenic
1145915232 17:28569947-28569969 CAGGTTAAGTGGGAAAAGGAGGG - Intronic
1146546476 17:33743077-33743099 CAGGATTATTTGCAAGAGCAGGG - Intronic
1148017715 17:44534086-44534108 CTGGAGAAGTTGGAATAGGATGG - Intergenic
1148127568 17:45244805-45244827 CAGGACAATCTGGGAGAGGCAGG - Exonic
1148842758 17:50509177-50509199 TGGGATTATTTGGTAGAGGAGGG + Intronic
1149900912 17:60477418-60477440 CTGGTTAATTTGGAACAGAAAGG - Intronic
1149919822 17:60647053-60647075 CAAGATAATTTTGAAGAAAAAGG - Intronic
1150007449 17:61478613-61478635 GAGGATGATCTGGAAGAGAAGGG - Exonic
1150343844 17:64389009-64389031 CAGGATAATTATGAAGATTATGG + Intronic
1151645577 17:75428832-75428854 CATGTTAATTTGGGAGAGGATGG - Intergenic
1151866050 17:76803712-76803734 CAGGATAATTTGGTGGGGGTGGG - Intergenic
1152399449 17:80056697-80056719 CAAGACAATTTTGAAAAGGAAGG + Intronic
1152400051 17:80060577-80060599 CAAGAAAATTTTGAAAAGGAAGG + Intronic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1152936704 17:83142422-83142444 GAGGAGAATGTGGATGAGGAAGG + Intergenic
1152987221 18:331862-331884 AAGGACAATTTAAAAGAGGATGG + Intronic
1153343761 18:4004415-4004437 CAGGTTAATTCGGAAGGGAAGGG - Intronic
1155325822 18:24663970-24663992 GAGGATAATTTTACAGAGGAAGG + Intergenic
1156797844 18:41069973-41069995 CAAGATAATGTGGAAGATGTAGG - Intergenic
1156903302 18:42326324-42326346 CAGGATAATTTGGCAGATAGGGG + Intergenic
1157163130 18:45333137-45333159 GAGTATAATTTGGCTGAGGAAGG - Intronic
1157438750 18:47693512-47693534 CAGTGTACTTTGGAAGAGGTGGG + Intergenic
1159082521 18:63751954-63751976 CATAATAATATGGAAGATGATGG + Intergenic
1163250496 19:16123890-16123912 CAGGAAAACCTGGAATAGGATGG + Intronic
1163398454 19:17077359-17077381 CAGGATATTCTGGAAGTGAAGGG - Intronic
1164001909 19:21108187-21108209 CCCAATAATTTGGAAGATGAAGG - Intronic
1164472433 19:28547277-28547299 CAGAATTATTTGGAAGAGGAGGG - Intergenic
1164630239 19:29757420-29757442 CAGGACACTTTGGAAGGGCAAGG - Intergenic
1165059709 19:33199133-33199155 CGGGATAATGGGGAAGAGGGAGG - Intronic
925208090 2:2024489-2024511 CATTTTAATTTGGCAGAGGAAGG - Intronic
927674368 2:25093746-25093768 CAGGACAGGTTGGATGAGGATGG - Intronic
928168575 2:28988707-28988729 CTGGAGAATTTGGATGAGAAAGG - Intronic
928276192 2:29902359-29902381 CAGGATGATGGAGAAGAGGATGG - Intronic
928868025 2:35941683-35941705 AGGGGTAATTTGGAAGAAGAAGG + Intergenic
931332300 2:61300301-61300323 AAGGAGAATGGGGAAGAGGATGG - Intronic
932724589 2:74168275-74168297 CAGAATAAAATGGAAGAGGCAGG + Intronic
932908842 2:75784329-75784351 AAGGATAATTTGGTCGATGAAGG + Intergenic
933260470 2:80126336-80126358 GAGGATCATTAGGGAGAGGAGGG - Intronic
935040407 2:99420708-99420730 CAGGGAACTTTGGAAGAAGAAGG + Intronic
937009593 2:118550722-118550744 TAGGATAAAGTGGGAGAGGATGG + Intergenic
937060890 2:118979723-118979745 GAGGAAATTTGGGAAGAGGAGGG - Intronic
937170417 2:119860506-119860528 CAAGCTAATTTGGCAGATGAGGG - Intronic
939480855 2:142745330-142745352 CAGGATAATGTGACAGAGGCTGG - Intergenic
939671598 2:145019237-145019259 CATGATTATTTGAAAGAGGAAGG - Intergenic
940733772 2:157425520-157425542 CATGATGTTCTGGAAGAGGATGG + Intronic
940838229 2:158549040-158549062 CAGGTTAACTTGGAAGACAAAGG + Intronic
941234845 2:162958756-162958778 AAGGATAAATTTAAAGAGGAAGG - Intergenic
942354994 2:175101177-175101199 TGGGATAATGTGGAAGTGGATGG + Intronic
942615709 2:177789536-177789558 CAGGACAATTAGGCAGAAGAAGG + Intronic
943772251 2:191731216-191731238 CAGGATAATGTGGAAGCCAAGGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944736376 2:202570379-202570401 CAGGATAGATTAGAAGGGGAGGG + Intergenic
946423979 2:219582349-219582371 CAGGGCAATCTGGAAGCGGAAGG + Intergenic
947137061 2:226985860-226985882 CTGGATAAACTGGAAGAGGTAGG - Intronic
948814984 2:240505948-240505970 CTGGATATTTAGGAAGGGGAAGG - Intronic
1169315907 20:4591156-4591178 CAGGTTAACTTGGAAGACAAAGG - Intergenic
1169525287 20:6417658-6417680 CAGGACAATGAGGAAGGGGAAGG + Intergenic
1171354444 20:24533530-24533552 GATGAGAATTTGGGAGAGGAGGG + Intronic
1171444976 20:25196454-25196476 CAGGAGAGCGTGGAAGAGGAAGG + Intronic
1176367672 21:6043703-6043725 GAGGTTGATTCGGAAGAGGAAGG - Intergenic
1176700772 21:10047208-10047230 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1177426907 21:20935121-20935143 CATGATATTTTGGAAGAGCTGGG + Intergenic
1177676135 21:24302195-24302217 CAATATAAGTTGGAACAGGAAGG - Intergenic
1178597081 21:33963863-33963885 CAGCATAAAATGAAAGAGGAGGG - Intergenic
1179755847 21:43494839-43494861 GAGGTTGATTCGGAAGAGGAAGG + Intergenic
1180854228 22:19036223-19036245 CAGGCTAAGGTGGAAGAGGCTGG - Intergenic
1181752185 22:24996604-24996626 CAGGATAATAGGGCAGGGGAGGG + Intronic
1181883673 22:26001697-26001719 CAGGAGCATGTGGAAGAGTAAGG + Intronic
1181893074 22:26081816-26081838 CAGGATAAGCGTGAAGAGGAAGG + Intergenic
1182030149 22:27152611-27152633 CAGGAAAATTTGGTTGATGATGG - Intergenic
1182073947 22:27482139-27482161 CAGGGGAATTTGGAAAGGGAAGG - Intergenic
1182333042 22:29564409-29564431 CAGCATCATTGGCAAGAGGAAGG + Intronic
1183226465 22:36553562-36553584 CAGGATAAGGTGGAAGAGGTGGG - Intergenic
1184321940 22:43748541-43748563 CAGGAACAATTGGATGAGGAAGG - Intronic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
949969440 3:9391427-9391449 CTGGCTAATTTGGTAGAGGTGGG + Intergenic
949971295 3:9407448-9407470 CATGATAAACTGTAAGAGGAAGG - Intronic
950387934 3:12674550-12674572 GAGGAGAATTAGTAAGAGGAAGG + Intergenic
951340382 3:21478880-21478902 CAGGAAAATTTGGAGGAGAAGGG + Intronic
952729971 3:36628453-36628475 AATGATAATGAGGAAGAGGACGG - Intergenic
953293119 3:41686340-41686362 CAGGGTTTCTTGGAAGAGGAAGG + Intronic
953359309 3:42280896-42280918 CATGAGATTTGGGAAGAGGAAGG + Intergenic
954992429 3:54853033-54853055 CATGAGAATTTGGAGCAGGAAGG - Intronic
955888660 3:63627048-63627070 GAGCATCATTTAGAAGAGGAAGG - Intergenic
956037897 3:65115523-65115545 CAGGATGAGTTTGGAGAGGATGG - Intergenic
956283239 3:67581466-67581488 CAGTATTTTTTAGAAGAGGAGGG + Intronic
956488796 3:69749732-69749754 GAGGATAACTTGTAAGAGGTCGG + Intronic
957376769 3:79368697-79368719 CAGTAGAATGTGGGAGAGGAAGG - Intronic
957935246 3:86934174-86934196 TAGGATACTTTGGAAGAGTGAGG - Intergenic
958112493 3:89166616-89166638 CAGGTGAATTTGGGAGAGAAAGG - Intronic
958755333 3:98244891-98244913 CAGGCTAAGGTGGAAGAGGGAGG - Intergenic
958957981 3:100481765-100481787 CAGGATAATATGGGAGGGAAAGG + Intergenic
961135989 3:124511743-124511765 CAGTATAGTTTGGTAGATGAAGG - Intronic
963596203 3:147328308-147328330 GAGGGTATTTTGGAAGAGGTGGG - Intergenic
963962137 3:151321774-151321796 CAAGATAATATGAAAGAGAAAGG - Intronic
964553259 3:157908689-157908711 CAGGAAAAATTGGAGGTGGAGGG + Intergenic
965160823 3:165130368-165130390 CAAGATAATTTGAGAGAGGTGGG - Intergenic
965442968 3:168738953-168738975 CAGGAAAATTTACAAGAGGAAGG + Intergenic
966417360 3:179703162-179703184 GAGAATTATTTGGAAGATGAGGG + Intronic
967564567 3:190958778-190958800 CAGGATAATTTGGGAAAGTTTGG + Intergenic
967974093 3:195021786-195021808 CAGGATAATTTGGAAGGATGGGG - Intergenic
968500685 4:948442-948464 GAGGACAGGTTGGAAGAGGAAGG + Intronic
968884997 4:3324131-3324153 CAGGTTAACTTGGAAGACAAGGG - Intronic
969960411 4:10939545-10939567 CAGGAAAATTTGGAAAAGTTTGG + Intergenic
970807141 4:20050239-20050261 GAGGAAAAATAGGAAGAGGAGGG - Intergenic
970957103 4:21825859-21825881 CAGGAAAATGTGAGAGAGGATGG + Intronic
971768432 4:30865137-30865159 TAAAATAATTTTGAAGAGGAAGG + Intronic
973056224 4:45662182-45662204 CCGGATAATTTCAAAGAGGAGGG - Intergenic
973258485 4:48137050-48137072 CAGGGTATTTGGGAAGGGGAAGG - Exonic
973986265 4:56356746-56356768 CAGGTTAACTTGGAAGACAAAGG + Intronic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974509017 4:62812968-62812990 TAGGAGAATTTTGAAGAAGAAGG - Intergenic
974772561 4:66434754-66434776 CAGGAAAATTTGGAAAAGTGTGG - Intergenic
976191451 4:82490986-82491008 CAGGTTAACTTGGAAGACAAAGG - Intronic
976888743 4:90017937-90017959 AAGGATAATTTTGCAGAGTATGG - Intergenic
977227859 4:94414679-94414701 CAGGCAAATGTGCAAGAGGAGGG - Intergenic
977504427 4:97883912-97883934 CAGGATAAATAGGAAAAGGAAGG + Intronic
978443617 4:108760024-108760046 CAGCAAAATATGGAAGAGAAAGG - Intronic
978473755 4:109101471-109101493 CAGGGTAATTTGGGAGAGCGGGG + Intronic
978749166 4:112227822-112227844 CAAGAGAATTTTGAAAAGGATGG + Intergenic
978912959 4:114086757-114086779 CAGGAAATTTTTGAAAAGGATGG + Intergenic
979023288 4:115531137-115531159 CAGGATGATATGGAACATGAGGG + Intergenic
980201386 4:129659575-129659597 CAGGAAAATATGGAAAAGGTTGG - Intergenic
981408163 4:144395676-144395698 CAGGACAATTAGGAAGGAGAAGG + Intergenic
982493424 4:156058868-156058890 CAGGGTATTGTGGAACAGGATGG - Intergenic
982592745 4:157335835-157335857 CACGAAAATTTGGAATGGGATGG + Exonic
984697147 4:182790599-182790621 CAGGTGAGTTTGCAAGAGGACGG - Intronic
985151226 4:186948983-186949005 GATGTCAATTTGGAAGAGGAAGG - Intergenic
985159864 4:187033453-187033475 CAGGAAAATGTGGAAGAGTTTGG + Intergenic
986941102 5:12951018-12951040 CAGGGTATTTTGAAATAGGAAGG - Intergenic
988075370 5:26346438-26346460 CACATGAATTTGGAAGAGGAAGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988401997 5:30775112-30775134 CAACAAAATTTGGAAGTGGAGGG + Intergenic
989300746 5:39889945-39889967 CAAGATAATTTAAAAGTGGATGG - Intergenic
989436110 5:41415709-41415731 CAAGAAAATTTAGAATAGGAAGG + Intronic
989503702 5:42200643-42200665 CAGCATAAGTTTTAAGAGGAAGG + Intergenic
989633678 5:43512251-43512273 GGGGATAATGTGGAAGGGGATGG - Intronic
990590260 5:57255267-57255289 CAGCATTATTTGGAATAAGAGGG - Intronic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
991651418 5:68858813-68858835 TAGGGTAAGATGGAAGAGGATGG + Intergenic
992472218 5:77069337-77069359 AAGGATAATTTGGCAGATGGGGG + Intergenic
994801680 5:104385132-104385154 AAGAATAAGTAGGAAGAGGAGGG - Intergenic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
995440829 5:112190531-112190553 AAAGAAAAGTTGGAAGAGGATGG + Intronic
995980741 5:118100102-118100124 CTGGAAAATTTAAAAGAGGAGGG + Intergenic
996387855 5:122927625-122927647 AAGTTTAATTTGGAAGAGAAAGG + Intronic
999144721 5:149384845-149384867 CAGGAGATTCTAGAAGAGGAAGG + Intronic
999717346 5:154371950-154371972 CGGGATGATTTGGAAGCGAATGG - Intronic
1000268468 5:159660051-159660073 CTGGATGAGATGGAAGAGGAGGG + Intergenic
1001371345 5:171206607-171206629 CAGGAAACTTTGGATAAGGAGGG - Intronic
1001501221 5:172236448-172236470 CTGTATTATTTGGAAGAGGTAGG - Intronic
1003666089 6:8112617-8112639 CAGGATGAATTGGAGGAGGAAGG - Intergenic
1004089205 6:12482619-12482641 TAGGATAATTTCTAAGAAGAGGG + Intergenic
1005446613 6:25930577-25930599 AAGGCTAACTTGGAAAAGGAGGG + Exonic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006923799 6:37643235-37643257 CAGGATGAGATGGAAGTGGAGGG - Intronic
1007250996 6:40494906-40494928 CAAGAGTACTTGGAAGAGGATGG - Intronic
1010287912 6:74100784-74100806 AAGGAAAACTTGGAAGAGAAAGG - Intergenic
1011360414 6:86518326-86518348 TAAAATAAGTTGGAAGAGGAAGG + Intergenic
1011575696 6:88795811-88795833 CACTATGATTTGGAAGGGGAAGG + Intronic
1013825272 6:114203744-114203766 AAGGATAATTTGGCAGAGAGAGG - Intronic
1014446123 6:121530101-121530123 CAGGAGGTTTTGAAAGAGGAAGG + Intergenic
1014544645 6:122719551-122719573 CAGGAAAATTAGGAAAATGATGG + Intronic
1015582707 6:134743939-134743961 CAGGATAATTTGGAAGGGAAAGG - Intergenic
1017440207 6:154457857-154457879 CAGGGAGGTTTGGAAGAGGACGG - Intronic
1017723409 6:157260045-157260067 GAGGATAATCTGGTGGAGGAAGG - Intergenic
1017848049 6:158276701-158276723 CAGAATAATTGGGAAGTGGTGGG + Intronic
1018290960 6:162292258-162292280 CAGAATAACTTGGAAGAGGCCGG - Intronic
1018831904 6:167449658-167449680 CAGAGTAATTTGTAAGAGTAGGG - Intergenic
1019476409 7:1246763-1246785 GAGGATGATTTGGGAGAGGAAGG + Intergenic
1019880604 7:3857266-3857288 CAGGACAAAATGGAAGGGGAAGG + Intronic
1021020902 7:15597724-15597746 TAGGATAATTTGCAAGATGCTGG + Intergenic
1022370288 7:29764832-29764854 CAGGATGATTTTGTAGAGTAAGG - Intergenic
1026788216 7:73315031-73315053 CAGGTTAACTTGGAAGACAAAGG + Intronic
1029283739 7:99452535-99452557 CTGGACAACTTGGGAGAGGAGGG + Intronic
1031608143 7:123793917-123793939 CAGGAAAATTTGGAAAAGTTTGG + Intergenic
1031965770 7:128027288-128027310 CAGGAGAAGGTGGAAGAGAAAGG - Exonic
1032980743 7:137279512-137279534 CAGATTAAGTTAGAAGAGGAAGG + Intronic
1033243993 7:139703579-139703601 CATGAGAATTAGGACGAGGAAGG + Intronic
1034073643 7:148211284-148211306 CAGGATATCTGGGAAGAGGTAGG + Intronic
1034196554 7:149252753-149252775 CTGGGTGACTTGGAAGAGGAAGG + Exonic
1035113016 7:156500221-156500243 AAAGATCATTTGGAAGAAGATGG + Intergenic
1036502799 8:9328994-9329016 CAGGATCAGTGGGAAGAGGTAGG - Intergenic
1037247741 8:16855896-16855918 CAGAAGAAAATGGAAGAGGATGG - Intergenic
1037255483 8:16947980-16948002 CAGGGCAATTAGGCAGAGGAAGG + Intergenic
1037811831 8:22090967-22090989 CAGGAGATTTTGGCAGTGGAGGG + Intronic
1037981925 8:23260483-23260505 CAGGAAAATCTTGAAGATGAAGG - Intronic
1038199368 8:25397266-25397288 CAGGATGGTTTGGAAGATTAAGG + Intronic
1038776231 8:30533415-30533437 TAGGAGAGTTTGGAAAAGGAGGG + Intronic
1041772584 8:61487832-61487854 CAGGATGAGTTTGAAAAGGATGG - Intronic
1042668010 8:71228872-71228894 CAGGGTGGGTTGGAAGAGGAAGG - Intronic
1042711766 8:71725396-71725418 TGGGATAATAAGGAAGAGGAAGG + Intergenic
1043061557 8:75511391-75511413 CAGGATAATTCTGAAGAATAGGG - Intronic
1044266730 8:90190796-90190818 CTGGATAGTTTGGACGAGGTTGG + Intergenic
1044817774 8:96130733-96130755 GAGGACAATTTGGATGTGGAAGG - Intergenic
1045566065 8:103317073-103317095 CAGGATAATTTTAGATAGGATGG + Intronic
1045981661 8:108196774-108196796 CTTGATAATTTTAAAGAGGATGG + Intergenic
1045996051 8:108363477-108363499 CAGTACAATTTTGAATAGGAGGG + Intronic
1047836937 8:128704162-128704184 AAGGAAAATTTGGGTGAGGAAGG - Intergenic
1048106391 8:131415013-131415035 TAGGATAAAATGGCAGAGGAAGG - Intergenic
1048237259 8:132703287-132703309 CAGGGTAACTTGGGAGTGGAGGG - Intronic
1048543537 8:135365036-135365058 CTTGAGAATTGGGAAGAGGACGG - Intergenic
1051890147 9:21932885-21932907 CAGAGTAATTAGGCAGAGGAGGG - Intronic
1052123408 9:24746207-24746229 CAGGAGAATTTTGAGGAAGAAGG - Intergenic
1052845424 9:33331710-33331732 CAGGATAATTTTTACGAAGAGGG + Intronic
1053637913 9:40033710-40033732 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1053768169 9:41431510-41431532 CAGGGTAATTAGGCAGGGGAAGG - Intergenic
1054546837 9:66343014-66343036 CAGGGTAATTAGGCAGGGGAAGG - Intergenic
1055162953 9:73153921-73153943 CAGGATGCTTTGGGAGAGCATGG + Intronic
1056967955 9:91179893-91179915 CAGAATTATTTGGGGGAGGAGGG + Intergenic
1058330834 9:103757726-103757748 CAGGATAATGTGGAAAAGTTTGG - Intergenic
1058473399 9:105304618-105304640 CATAATAGTTTTGAAGAGGAAGG + Intronic
1058714597 9:107712502-107712524 CAGACTCATGTGGAAGAGGAAGG - Intergenic
1059785016 9:117572119-117572141 AAGGATAATTTGGTGGATGAAGG - Intergenic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061240346 9:129367366-129367388 CAGGATAAATTGGAAAGGTAGGG + Intergenic
1062456268 9:136640688-136640710 CTGGAGTATTTGGAAGAGCATGG - Intergenic
1202785783 9_KI270719v1_random:17266-17288 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1186012267 X:5147718-5147740 AAGGATACATTGGAAGTGGAGGG + Intergenic
1186527150 X:10259121-10259143 TAAGATAACTTGGAAGATGAAGG + Intergenic
1187076911 X:15944379-15944401 CAGGACAATTCTGCAGAGGAAGG + Intergenic
1187567169 X:20462539-20462561 CAGAATAATTTTGCATAGGATGG - Intergenic
1188012888 X:25076067-25076089 AAGGATAATCAGGAAGAGAATGG - Intergenic
1188247847 X:27856002-27856024 CAGTATAATTTGGAAAATTAAGG + Intergenic
1189259702 X:39669644-39669666 CAAGATAACTTGGCAGAGCAAGG - Intergenic
1193727075 X:85054381-85054403 CAGTACAATTTGGAAAAGGTAGG + Exonic
1193750030 X:85330051-85330073 CAAAATAATTTGGAAGATAAAGG - Intronic
1194397629 X:93404791-93404813 CAGGAAAATGTGGAAAAGTATGG - Intergenic
1194898305 X:99472849-99472871 CAGGATACTATGAAAAAGGAAGG - Intergenic
1194961371 X:100240086-100240108 CAGGTTGATCTGGAAGAGAAAGG - Intergenic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1196209512 X:112980369-112980391 TAGGATAAATTGCTAGAGGAGGG + Intergenic
1199665716 X:150094964-150094986 CTGGATGGCTTGGAAGAGGAAGG - Intergenic
1201618588 Y:15929198-15929220 CAGGTCAATTAGGAAGAAGAAGG + Intergenic