ID: 1125188366

View in Genome Browser
Species Human (GRCh38)
Location 15:36959470-36959492
Sequence TTAGTTCAACACGTATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 427}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125188366_1125188367 -8 Left 1125188366 15:36959470-36959492 CCAATAAATACGTGTTGAACTAA 0: 1
1: 0
2: 5
3: 74
4: 427
Right 1125188367 15:36959485-36959507 TGAACTAATCAAGTTTGAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125188366 Original CRISPR TTAGTTCAACACGTATTTAT TGG (reversed) Intronic
900343736 1:2200946-2200968 CCAGTTCAGCACGTTTTTATGGG + Intronic
901690411 1:10969592-10969614 TTCATTCAACAAATATTTATTGG + Intronic
902371233 1:16008339-16008361 TTTATTCACCAAGTATTTATTGG + Exonic
902707822 1:18217973-18217995 TTCCTTCAACAATTATTTATTGG + Intronic
903312759 1:22472702-22472724 TCAGTTCAGCATATATTTATTGG + Intronic
904220697 1:28966422-28966444 TTTGTTCAACTCATATTTTTTGG + Intronic
904252565 1:29235718-29235740 TTCATTCAACAAATATTTATTGG - Intergenic
905483744 1:38280877-38280899 TTGATTCAACAACTATTTATGGG + Intergenic
906098424 1:43239997-43240019 TCAATTCAATACATATTTATTGG - Intronic
906332480 1:44898451-44898473 TTTATTCAACAACTATTTATTGG - Intronic
906410010 1:45570712-45570734 TTTGTTCAAGAAGTATTTATTGG + Intergenic
907660713 1:56390207-56390229 TTTATTCAACAAATATTTATTGG - Intergenic
909579718 1:77220776-77220798 TTAATTCAACAGATATCTATTGG + Intergenic
909586223 1:77291660-77291682 CTAATTCAACAAATATTTATTGG + Intronic
910152483 1:84167675-84167697 TTAATTCTATAAGTATTTATTGG - Intronic
911211345 1:95141697-95141719 TTAATTCAACATATGTTTATTGG - Intronic
911689742 1:100819931-100819953 TAAGCTCAAGACTTATTTATTGG + Intergenic
912148742 1:106829458-106829480 TTAGTTGAACATGTATGTATGGG - Intergenic
912727159 1:112068514-112068536 CTTGTTCAACAAGTATGTATAGG - Intergenic
913614582 1:120545648-120545670 ATAGTTCAATACTTATTTTTTGG + Intergenic
914575689 1:148965253-148965275 ATAGTTCAATACTTATTTTTTGG - Intronic
914934150 1:151963314-151963336 TTCATTCAATAAGTATTTATTGG + Intergenic
914959109 1:152190241-152190263 TTCATTCAACAAATATTTATTGG + Intergenic
915336154 1:155143338-155143360 CTAGTTCAACAAATATTTTTCGG - Intergenic
915358424 1:155270736-155270758 TTTGTTCAACAAATACTTATTGG - Intronic
915620270 1:157078298-157078320 TTAATTCAACAAGTATTTATGGG - Intergenic
916545110 1:165796765-165796787 TTAATTCAACAAGTATGTATGGG + Intronic
916684299 1:167130782-167130804 TTCGTTCAACACTTATTCAGTGG - Intergenic
916685204 1:167138120-167138142 TTCATTCAACAAGTATTCATGGG + Intergenic
916740766 1:167645309-167645331 TTTGTTCCACAAATATTTATTGG + Intronic
918319449 1:183350911-183350933 TGAGTTCAACATGTATTTGAAGG + Intronic
918900446 1:190409683-190409705 TTTGTGCAATACATATTTATTGG + Intronic
919047086 1:192465895-192465917 TTAATTCAACAAATATTTGTTGG + Intergenic
919516977 1:198537817-198537839 TTAATTCAATAAGTGTTTATTGG - Intronic
919692996 1:200544211-200544233 TTTATTCAACAGGTATTTACTGG + Intergenic
921103265 1:211950177-211950199 TCAGTTCAACAAGTATTTATGGG - Intronic
921622004 1:217335632-217335654 TTCTATCAATACGTATTTATTGG - Intergenic
922121601 1:222674861-222674883 TTAGTTCAACATGTATGCAAAGG + Intronic
1063602429 10:7494322-7494344 TTTGCTCAACAAATATTTATTGG - Intergenic
1065770428 10:29073110-29073132 TCAGTTCAACACTTCCTTATTGG + Intergenic
1065770886 10:29077334-29077356 CTAATTCAGCAAGTATTTATTGG - Intergenic
1066004219 10:31132733-31132755 TTGGCTCAACAAGTATTTATGGG + Intergenic
1066385157 10:34935614-34935636 TTCGTTCAACATATATTTATGGG + Intergenic
1070413430 10:76166149-76166171 TAACTTCCACACATATTTATGGG + Intronic
1071117139 10:82234575-82234597 TTCATTCAACAATTATTTATTGG - Intronic
1071612005 10:87040311-87040333 TTAGTTCATCACCTATTGTTAGG + Intergenic
1071756774 10:88550736-88550758 TTAGTTAAACACAAATTCATAGG - Intronic
1071993055 10:91119136-91119158 TCCATTCAACAAGTATTTATTGG - Intergenic
1072794281 10:98342558-98342580 TCAATTCAACAAATATTTATTGG - Intergenic
1072868523 10:99090376-99090398 TTCGTTCAGAACATATTTATTGG - Intronic
1074610773 10:115019005-115019027 TTCATGCAACAAGTATTTATTGG - Intergenic
1075216442 10:120540405-120540427 TTTGTTCCACACATATTTACTGG + Intronic
1075277993 10:121112730-121112752 TTAATTCAACAAATATTTACTGG + Intergenic
1075380066 10:122011801-122011823 TTAATTGAACAAATATTTATTGG + Intronic
1076565314 10:131394550-131394572 TTAATTCAACATGGATTTGTAGG - Intergenic
1078114371 11:8430771-8430793 ATAATTCAACAAATATTTATTGG - Intronic
1078819188 11:14859752-14859774 TTCATTCAACAAGTATTTATTGG + Intronic
1079530144 11:21442437-21442459 TTAGATCCACAAGTATTTCTTGG - Intronic
1080050795 11:27856932-27856954 TTCATTCAACAAATATTTATTGG - Intergenic
1080072333 11:28104762-28104784 TTTATTCAACAAGTATTTATTGG - Intronic
1080074002 11:28126478-28126500 TTATTTCAACAAATATTTATGGG - Intronic
1081034571 11:38126940-38126962 TTCATTCAATACATATTTATGGG + Intergenic
1081067228 11:38559654-38559676 TGAGTTCCAGACGTATCTATTGG + Intergenic
1081232257 11:40599702-40599724 TTATTCCAACAAATATTTATTGG - Intronic
1081400048 11:42632888-42632910 TTAATTCAACAAGCATTTACTGG - Intergenic
1082194213 11:49282543-49282565 TTAATTAAACACCTATATATGGG + Intergenic
1083982974 11:66189401-66189423 TTTATTCAACAAATATTTATTGG + Intronic
1084131703 11:67140820-67140842 TTAATTCACCAGTTATTTATTGG + Intronic
1086671939 11:89558496-89558518 TTAATTAAACACCTATATATGGG - Intergenic
1087216275 11:95498609-95498631 TTATTTTAACAAATATTTATTGG + Intergenic
1087995640 11:104804770-104804792 TCAATTCAACACACATTTATTGG + Intergenic
1088100399 11:106148160-106148182 TTTGTTCAAAATATATTTATTGG + Intergenic
1088205689 11:107389583-107389605 TTATTTTAACACGTCATTATGGG - Intronic
1088273614 11:108060907-108060929 TTCATTCAACAGGTACTTATTGG + Intronic
1089113653 11:116076856-116076878 TTAATTCAACAAGTATATGTTGG + Intergenic
1089977515 11:122745351-122745373 TTCATTCAGCAAGTATTTATGGG + Intronic
1090313735 11:125766439-125766461 TTCCTTCAACAAGTATATATTGG + Intergenic
1090441051 11:126725982-126726004 TTCATTCAAGAAGTATTTATGGG - Intronic
1091454091 12:592343-592365 TTTGTTCAACACCTGTTTGTTGG - Intronic
1092071956 12:5638556-5638578 TAAGTTCAATACGTATTTTCTGG + Intronic
1092098715 12:5865197-5865219 TCAATTCAACAAGTATTTATTGG + Intronic
1092642457 12:10530013-10530035 TTAGTCCATAACATATTTATAGG + Intergenic
1093530607 12:20157826-20157848 TTCATTCAACAAATATTTATTGG - Intergenic
1093771078 12:23019439-23019461 TTAGTTCATCACTTATATAGAGG - Intergenic
1093938301 12:25025077-25025099 TTCATTCAACACGTATTCATTGG + Intronic
1094154281 12:27321234-27321256 TTTTTTCAACAAATATTTATTGG - Intronic
1095158379 12:38886526-38886548 TTCTTTCAACACAGATTTATTGG + Intronic
1095405858 12:41866550-41866572 TTCGTTCAACAAATATTTAGTGG - Intergenic
1095614861 12:44176327-44176349 TTCATTCCACAGGTATTTATTGG - Intronic
1095682038 12:44988592-44988614 TTATTTCAACAGGTTTTTATTGG - Intergenic
1095975636 12:47939246-47939268 TTAGCTCAACACATGCTTATTGG - Intronic
1096243347 12:49971194-49971216 TTCATTCAACAAATATTTATTGG + Intronic
1097641160 12:62183733-62183755 TTTATTCAATAAGTATTTATTGG - Intronic
1097813379 12:64043894-64043916 TTAATTCAAAATATATTTATTGG + Intronic
1098427799 12:70385174-70385196 TTAGTTCAACAAATGTTTATTGG + Intronic
1099445444 12:82746409-82746431 TTAATTGAACACATATTTATGGG + Intronic
1100090674 12:90966009-90966031 TTAGTTCAACTAGTTTTTAGTGG + Intronic
1100924640 12:99530839-99530861 TTTATTCAACAAATATTTATTGG - Intronic
1101259046 12:103010505-103010527 TTAATTCAAAAAGTGTTTATTGG - Intergenic
1101590106 12:106117938-106117960 TAAGCTCAACAAATATTTATTGG - Intronic
1101752042 12:107589815-107589837 TTCATTCAACAATTATTTATTGG - Intronic
1101931924 12:109021727-109021749 TTTATTCAACAAATATTTATGGG - Intergenic
1102227914 12:111242025-111242047 TCATTTCAACAAATATTTATTGG + Intronic
1102633866 12:114305421-114305443 TCAGTTCAAGACGCATTAATTGG - Intergenic
1102761070 12:115385714-115385736 TTCATTCAACACGTATTTGCTGG - Intergenic
1104144692 12:126021527-126021549 TTAGTTTTGCATGTATTTATTGG + Intergenic
1105415771 13:20210293-20210315 TTAGTTCAACATCCACTTATTGG + Intergenic
1105458653 13:20564268-20564290 TTAATTCAACAAATATTTCTTGG + Intergenic
1105645113 13:22309628-22309650 TTTATTCAAGACATATTTATTGG + Intergenic
1105928092 13:25026082-25026104 TCAATGCAACACATATTTATGGG + Intergenic
1105942797 13:25164999-25165021 TCAATGCAACACATATTTATGGG - Intronic
1106058261 13:26259784-26259806 TTCATTCAACAAGTATTTATTGG + Intronic
1106618400 13:31351748-31351770 TTCATTCAACAAGTATTTACTGG - Intergenic
1106630786 13:31470383-31470405 TTATTTCAACCAATATTTATTGG + Intergenic
1107412978 13:40174670-40174692 TTAGTACAAAACGTAATTAATGG + Intergenic
1107816265 13:44247262-44247284 TTGGTTCAATAAATATTTATTGG - Intergenic
1108028354 13:46202112-46202134 TTGGTTCAATAAGGATTTATTGG - Intronic
1108684975 13:52811349-52811371 TCAGTTCAACATACATTTATTGG - Intergenic
1109006583 13:56885340-56885362 TTAGTTCAACAAACATTTATTGG - Intergenic
1109663747 13:65501612-65501634 TTTGTTCACCACTTATTCATTGG - Intergenic
1109956311 13:69571590-69571612 TTCATTCAATATGTATTTATTGG - Intergenic
1110015180 13:70391145-70391167 TTTTTTCAGCAAGTATTTATTGG + Intergenic
1110072837 13:71199339-71199361 TTTGTTCAACAAGTATTTTTTGG - Intergenic
1110081853 13:71323284-71323306 TCAATTCAACACATATTTATTGG - Intergenic
1110248133 13:73351126-73351148 TTTGTTTAACATATATTTATGGG - Intergenic
1110391685 13:74981783-74981805 TGAGCTCAATAAGTATTTATTGG + Intergenic
1110790928 13:79585881-79585903 CTTGTTCAACAAGTATTTATTGG + Intergenic
1111139948 13:84103759-84103781 TCAGTTCAACTTATATTTATTGG + Intergenic
1111366988 13:87260514-87260536 TAAGTACAAAATGTATTTATGGG + Intergenic
1111625142 13:90775231-90775253 TTTATTCAACAAGTACTTATTGG - Intergenic
1111918450 13:94385705-94385727 TTAATTCAGCAAGTCTTTATTGG - Intronic
1111954216 13:94739484-94739506 TTAATTCAACAAATATTTCTAGG + Intergenic
1112728377 13:102330923-102330945 TTTATTTAACACATATTTATTGG - Intronic
1114660611 14:24341289-24341311 TCAATTCAACAAATATTTATTGG - Intergenic
1115449913 14:33535584-33535606 TTAATTCATTAGGTATTTATTGG - Intronic
1115972092 14:38956115-38956137 TTGATTCAACATGTATTTATTGG - Intergenic
1116328589 14:43566892-43566914 TTAATTCAGCATGTAATTATAGG - Intergenic
1116884353 14:50205040-50205062 TTCTTTCAACAAATATTTATAGG - Intronic
1117391089 14:55263632-55263654 TTAATTCAACAGATATTTATTGG + Intergenic
1118579205 14:67276517-67276539 TGAGTTGAACAGATATTTATTGG + Intronic
1119127577 14:72141957-72141979 TTACTTCAATATGTATTTAATGG - Intronic
1119341359 14:73881575-73881597 TTAATTTAACAAATATTTATGGG + Intronic
1119373919 14:74172967-74172989 TTCATTCAATACGTATTTATTGG - Intronic
1119905736 14:78300152-78300174 ATATTTCCACACATATTTATGGG - Intronic
1120459540 14:84777138-84777160 TAATTTTAACAAGTATTTATAGG + Intergenic
1121942108 14:98080912-98080934 CTAGTTCAACAAGTAAGTATTGG - Intergenic
1121958736 14:98239122-98239144 TCTGCTCCACACGTATTTATGGG - Intergenic
1122238981 14:100349413-100349435 TTTGTTCTACAAATATTTATTGG - Intronic
1122580492 14:102768742-102768764 GAAGTTCAACAGATATTTATTGG + Intergenic
1124469960 15:29975545-29975567 CAAGTTCAACAAATATTTATTGG - Intergenic
1125188366 15:36959470-36959492 TTAGTTCAACACGTATTTATTGG - Intronic
1125882410 15:43206158-43206180 TTCATTCAACACATATTTATTGG - Intronic
1126347724 15:47714852-47714874 TCTGTTTAACAAGTATTTATTGG + Intronic
1127407690 15:58668783-58668805 TAAATTCAACAAGTATTTATTGG - Intronic
1127536412 15:59893895-59893917 TTAATTCAACAACTATTTACAGG + Intergenic
1127861609 15:62998390-62998412 TTAAGTCAACAGGTATTTACTGG + Intergenic
1129820895 15:78601196-78601218 TTCATTCAACAAATATTTATGGG - Intronic
1130527342 15:84718629-84718651 TAAATTCAACAAGTATTTATTGG - Intergenic
1133517639 16:6525122-6525144 TTTGGTCAACCTGTATTTATTGG + Intronic
1135078171 16:19411785-19411807 TTCATTCAACAAGTATTTATAGG - Intronic
1135481697 16:22826053-22826075 TTAGTTCCACATGAATTTATTGG + Intronic
1135701417 16:24635972-24635994 TTAATTCATTACATATTTATTGG + Intergenic
1135850094 16:25955672-25955694 TTCATTCAACAAGCATTTATAGG + Intronic
1135863871 16:26082412-26082434 TTAGATCATCACATATTTAAGGG + Intronic
1138314010 16:56052772-56052794 TCAATTCAACAAGGATTTATCGG + Intergenic
1138580578 16:57938293-57938315 TAACTTCAACACATATTTATAGG - Intronic
1139168343 16:64598401-64598423 TTCATTCAACACATATATATTGG + Intergenic
1139169080 16:64609232-64609254 TTAGTTCCACAGGTTTTTGTTGG - Intergenic
1139604950 16:68011540-68011562 TTTATTCAACAAGTATTTATTGG - Intronic
1140590027 16:76340622-76340644 TTCATTCAATACATATTTATAGG + Intronic
1141356795 16:83354380-83354402 TTCATTCAACAAGTATTTATCGG + Intronic
1143706430 17:8700817-8700839 TTCATTCAACAAATATTTATGGG - Intergenic
1144325905 17:14179540-14179562 TTCATTCAACACATATTTCTGGG - Intronic
1144474778 17:15576428-15576450 TTCATTCAACACATATTTCTGGG - Intronic
1144587795 17:16498527-16498549 TTCATTCAGCAAGTATTTATGGG - Intergenic
1144595495 17:16567061-16567083 TTATTTCAAGACGTTTTTCTTGG + Intronic
1145039277 17:19565040-19565062 GTAATTAAACAAGTATTTATTGG + Intronic
1147600069 17:41739918-41739940 TTCATTCAACAAATATTTATTGG - Intergenic
1148249678 17:46065425-46065447 TTCTTTCAACAAATATTTATTGG - Intronic
1148326684 17:46787239-46787261 TTTCTTCAACAGGTCTTTATTGG - Intronic
1150674815 17:67235655-67235677 TCAGTTCAGCAAGTATTTATTGG - Intronic
1151069607 17:71193714-71193736 TTCATTCAACAAATATTTATTGG + Intergenic
1151151327 17:72090056-72090078 TTCATTCAACAAATATTTATCGG - Intergenic
1151160894 17:72164882-72164904 TCAATTCAACATGTATTTTTGGG - Intergenic
1153091683 18:1353765-1353787 TAAATTCAACACTCATTTATTGG + Intergenic
1153740086 18:8115866-8115888 TTAGCTCAACAAATATTTCTTGG + Intronic
1154214216 18:12403678-12403700 TAAATTCAATACATATTTATTGG + Intergenic
1155315901 18:24569769-24569791 TTCATTCAACAGGTATTTGTTGG - Intergenic
1155637583 18:27973994-27974016 CTAGTTGAAAATGTATTTATTGG - Intronic
1156595671 18:38544979-38545001 ATACTTCAGCACGTATTGATTGG - Intergenic
1157285914 18:46377308-46377330 TTCCTTCAACAAGTATTTATGGG + Intronic
1157684292 18:49630232-49630254 TTAAATCAACACACATTTATTGG + Intergenic
1158167448 18:54556414-54556436 TTAATTCAAGAAATATTTATTGG - Intergenic
1158376705 18:56878490-56878512 TTAATTTAACAAATATTTATTGG - Intronic
1159233328 18:65637138-65637160 TTCGTTCAACAAATATTTATTGG + Intergenic
1161267539 19:3371467-3371489 TTCGTGCAACAGGTATTTATTGG - Intronic
1161433848 19:4250294-4250316 TTCATTCAACACTCATTTATTGG + Intronic
1161856792 19:6770481-6770503 TTCATTCAACAGGTATTTAAGGG + Intergenic
1164720709 19:30429880-30429902 TTAGTTCAACCAGAATTTGTAGG + Intronic
1165789842 19:38484669-38484691 TTCATTCAACAAATATTTATGGG + Intronic
1167039647 19:47015480-47015502 TTCATTCAACAAATATTTATCGG - Intergenic
1167210232 19:48129552-48129574 TTCGTTCAGCAAGTATTTACTGG - Intronic
925156524 2:1652450-1652472 TTATTTCAACAAGTATTTATTGG - Intronic
925742037 2:7014269-7014291 TTCATTCAACAACTATTTATGGG - Intronic
926882106 2:17557331-17557353 TTCTTTCAACAAATATTTATTGG + Intronic
926976837 2:18524005-18524027 TTAGTTCGACACATATTTACAGG + Intergenic
927092455 2:19722414-19722436 TTTGTTAAACACATATTTATGGG - Intergenic
927466855 2:23343366-23343388 TTCATTCAATATGTATTTATAGG + Intergenic
927468630 2:23355641-23355663 TTAATATAACAAGTATTTATAGG + Intergenic
927778325 2:25919248-25919270 TTTTTTCTACACGTATTCATCGG - Intergenic
927830348 2:26344958-26344980 TTCGTTTAACAACTATTTATTGG - Intronic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
928240579 2:29582019-29582041 TTCATTCAACAAGCATTTATTGG + Intronic
928276600 2:29906390-29906412 TTAATTCAACAAATAATTATTGG - Intronic
928386278 2:30871311-30871333 TTCATTCAACAAGTATTTGTCGG + Intergenic
929315548 2:40473593-40473615 TTTGTTCAACAAATATTTATGGG - Intronic
929368509 2:41192161-41192183 TTCATTCAACAACTATTTATTGG - Intergenic
929554629 2:42918068-42918090 TCAATTCAACACATAATTATGGG + Intergenic
929739005 2:44583191-44583213 TTCATTCAACAAGTATCTATTGG + Intronic
929770473 2:44887646-44887668 TTCATTCAACACATATTTACTGG - Intergenic
931004545 2:57833059-57833081 TTTATTCAATACATATTTATAGG + Intergenic
931009964 2:57899456-57899478 TAAATTCAGCAGGTATTTATTGG + Intergenic
931598046 2:63971954-63971976 TTAGTTCAACAAATATTGATTGG - Intronic
931680477 2:64743361-64743383 TTAATTCAACAGATATTTATTGG - Intronic
932443113 2:71750609-71750631 TTTGTTCAATAAGCATTTATTGG + Intergenic
933534028 2:83549534-83549556 TTATTTCAACACGTTTTACTAGG - Intergenic
933711867 2:85332654-85332676 TTAGTCAAACACTTATTTAGGGG - Intergenic
935396624 2:102616916-102616938 TTCGTCCAACACATATTTAGCGG + Intergenic
937658128 2:124400156-124400178 TTCATTCAACAAGGATTTATGGG + Intronic
938251129 2:129816706-129816728 TTGGTGCACCACGCATTTATTGG + Intergenic
938840397 2:135156291-135156313 TTATTTCAACACATAATAATTGG + Intronic
939819825 2:146944176-146944198 TTTATTCAACAAGTATTTATTGG + Intergenic
939967652 2:148626225-148626247 TTCATTTAACAAGTATTTATTGG + Intergenic
942145140 2:173019346-173019368 TTCGTTCATCACATATTTACTGG + Intronic
942216357 2:173723175-173723197 ATAGTTCAACATTTATTTATGGG - Intergenic
942351062 2:175053369-175053391 TTAATTCAACATCTATTTTTTGG - Intergenic
942538807 2:176994207-176994229 TTGATTCAACAAATATTTATTGG + Intergenic
942941457 2:181623637-181623659 TTTGTTCAACGATTATTTATTGG - Intronic
942956808 2:181782985-181783007 TTTGTTCAACATTTATTTAGTGG - Intergenic
943113015 2:183629972-183629994 TTTATTCAACACCTATATATTGG + Intergenic
943137244 2:183929268-183929290 TTTGATCAACAAGTATTTACTGG - Intergenic
943567129 2:189529329-189529351 TTCATTCAACAAATATTTATTGG + Intergenic
943567657 2:189535538-189535560 TTCATTCAACATATATTTATTGG + Intergenic
944059421 2:195556759-195556781 TTAGGTCAACAGGTATAAATTGG - Intergenic
945005949 2:205406467-205406489 TTAGTTCATCACATAAATATTGG + Intronic
945270688 2:207936378-207936400 TTTGTTCAACAAGTATTTATTGG - Intronic
945340249 2:208644174-208644196 TCAGTTCAACAAATATTTATTGG + Intronic
945858924 2:215098569-215098591 TTTGTTCAACAAATATTTGTTGG + Intronic
945921381 2:215758299-215758321 TTCCTTCAACAAGAATTTATAGG - Intergenic
946832261 2:223738920-223738942 TTAATACAACAAGTATTAATTGG + Intergenic
947087119 2:226465880-226465902 TGAGTTCAAGGCATATTTATGGG - Intergenic
947481795 2:230507429-230507451 TTGGTTCAATAAGTATTTACTGG - Intronic
947817948 2:233050662-233050684 TTAATTCAACACATGTTTATTGG + Intergenic
947880641 2:233507946-233507968 TTAAATTGACACGTATTTATGGG - Intronic
1169650066 20:7857176-7857198 TTAACTCAACAAATATTTATTGG - Intergenic
1170187584 20:13608401-13608423 TTAATTCAACAAATATTTATTGG + Intronic
1170445714 20:16425410-16425432 TTATTTCTACACTTATTAATTGG - Intronic
1171997204 20:31740862-31740884 TCAATTCAACAGGTATTTAGTGG - Intronic
1172532102 20:35639117-35639139 TTAGTGCAACATTTGTTTATGGG - Intronic
1172929837 20:38578446-38578468 TTGCTTCAACAAGTATTTACTGG - Exonic
1173059730 20:39650166-39650188 TTAAATCAACAAATATTTATTGG + Intergenic
1173347755 20:42216382-42216404 TTAATTCAACAGGTCTTTACAGG - Intronic
1174531771 20:51220022-51220044 TTCGTTCAACATATATTCATGGG + Intergenic
1177405966 21:20668614-20668636 TCATTTAAACACATATTTATTGG + Intergenic
1181900910 22:26155009-26155031 TTTGCTCAACAAGTATTTATTGG - Intergenic
1182587591 22:31353949-31353971 TTCATTCAAGAAGTATTTATGGG + Intergenic
1182954990 22:34415751-34415773 TTCATTCAAAAGGTATTTATTGG + Intergenic
1183237873 22:36633294-36633316 TTCATTCAACACATAGTTATTGG - Intronic
949197402 3:1328899-1328921 TTTGTTCAACATATATTTAGTGG + Intronic
949216062 3:1568499-1568521 TTTATTCAACAAATATTTATTGG - Intergenic
949442218 3:4094259-4094281 CTCCTTCAACAAGTATTTATTGG + Intronic
949833926 3:8247308-8247330 TTATTTCAACAGGATTTTATTGG - Intergenic
951369530 3:21828564-21828586 TTTGTTCTACAAATATTTATTGG + Intronic
951772429 3:26273451-26273473 TTCATTCATCAAGTATTTATTGG + Intergenic
952961837 3:38597124-38597146 TGAATTCAACAAATATTTATTGG + Intronic
954243075 3:49309390-49309412 TTAATTCATCAAATATTTATTGG - Intronic
955607393 3:60720362-60720384 TTTATTCAACAAATATTTATGGG - Intronic
955821684 3:62902426-62902448 TTGATTCAACATATATTTATGGG + Intergenic
956786492 3:72647186-72647208 TTATTTCAACACATATTAACTGG + Intergenic
956813488 3:72887652-72887674 TTTATTCAACAGATATTTATTGG + Intergenic
957602526 3:82356470-82356492 TTAGTTTAGCAAATATTTATTGG + Intergenic
960458507 3:117903274-117903296 TTCATTCAACAAATATTTATAGG - Intergenic
960692208 3:120358563-120358585 TTAATTCAACAAATACTTATTGG + Intergenic
960694657 3:120384302-120384324 TTAATTCAACAAGTATTGGTTGG - Intergenic
961099256 3:124184800-124184822 TTAATTCAACAATCATTTATTGG - Intronic
962200201 3:133394711-133394733 TTAGTTCAACACCTATCTAAGGG - Intronic
962514553 3:136138230-136138252 TTATTTCAACAGATATTTACTGG + Intronic
963939111 3:151083175-151083197 TTATCTTAACACTTATTTATTGG - Intergenic
964449081 3:156792777-156792799 TTCATTCAACAAATATTTATTGG + Intergenic
964463103 3:156958662-156958684 TTTTTTCAGCAAGTATTTATTGG + Intronic
964727821 3:159833159-159833181 TTAAATCAACACAAATTTATTGG + Intronic
965491885 3:169347831-169347853 GTCAGTCAACACGTATTTATTGG - Intronic
966164237 3:176999146-176999168 TAAGTTCAACAAATATTTAATGG + Intergenic
967581712 3:191165521-191165543 TTAGTTCAAGACATGATTATTGG - Intergenic
967698593 3:192565347-192565369 TTAGTTGAACACTAAATTATAGG + Intronic
967856342 3:194120342-194120364 TTTCTTCAACACTTATTAATGGG - Intergenic
968863099 4:3188311-3188333 TTGATACTACACGTATTTATTGG - Intronic
969629112 4:8325174-8325196 TTCATTCAACAAATATTTATTGG - Intergenic
969631739 4:8343050-8343072 TTTGTCCAACAAGTATTCATTGG + Intergenic
969997267 4:11325749-11325771 TTTATTCAACAAATATTTATTGG + Intergenic
971060293 4:22960722-22960744 TTCATTGAACATGTATTTATAGG + Intergenic
971257244 4:25026121-25026143 TGAGTTCAACAGGTAGGTATTGG - Intronic
971832050 4:31707106-31707128 TTAATTCAACAAATATGTATTGG - Intergenic
973038252 4:45436371-45436393 TTAATTTAAAAAGTATTTATTGG - Intergenic
973246668 4:48017045-48017067 GGCGTTCAACACTTATTTATGGG + Intronic
973253466 4:48085064-48085086 TTTGTTCAACATTTATTTAGAGG - Intronic
973671282 4:53220467-53220489 TTATTTCAACAAATAATTATTGG - Intronic
974690807 4:65295309-65295331 TTCACTCAACAAGTATTTATAGG + Intergenic
974724025 4:65776431-65776453 TTAATTCAACATATAGTTATTGG - Intergenic
975544869 4:75550118-75550140 TTCATTCAACAACTATTTATTGG - Intronic
975761320 4:77623323-77623345 TTAGTTCCACACATAATTAGAGG - Intergenic
976133765 4:81912727-81912749 TTAATGCAACAATTATTTATTGG - Intronic
977839570 4:101686162-101686184 TTAATTCAACAAATATGTATTGG + Intronic
978245470 4:106567048-106567070 TTCATTCAACAAGTATTTATTGG + Intergenic
978315437 4:107430666-107430688 TTCATTCAACAAATATTTATTGG - Intergenic
978787546 4:112626632-112626654 TTTGTTCAACAAATATTTTTTGG - Intronic
979476763 4:121167698-121167720 TTAGTTCATCATGTATTAAATGG + Intronic
980220041 4:129902233-129902255 TCAGTTAAACAAGTAATTATAGG - Intergenic
980544840 4:134245424-134245446 TTTATTCAACAAATATTTATTGG - Intergenic
981470497 4:145128888-145128910 TTTTTACAACATGTATTTATGGG - Exonic
981761227 4:148197390-148197412 TTAATTCAATAAGTATTTATGGG + Intronic
981762065 4:148205566-148205588 TTAATTCAACAAATAATTATCGG + Intronic
981773884 4:148342362-148342384 TTAATTCAACAAACATTTATAGG + Intronic
981951269 4:150410724-150410746 TTCATTTAACATGTATTTATTGG - Intronic
982472253 4:155806716-155806738 TAAATTCAACAAATATTTATTGG - Exonic
982906092 4:161074388-161074410 ATAGTTCAATATTTATTTATAGG - Intergenic
983706440 4:170665923-170665945 TTAATTCAATACATATTTATTGG + Intergenic
983803506 4:171965173-171965195 TTGATTCAACAAATATTTATGGG - Intronic
984346410 4:178532800-178532822 TTTATTCTACATGTATTTATTGG + Intergenic
984570601 4:181388188-181388210 TTCATTCAACAAATATTTATTGG + Intergenic
984674344 4:182529721-182529743 TTTGTTCAACACCAATTTATGGG + Intronic
984843045 4:184086019-184086041 TTTATTCAACACATATTTACGGG + Intergenic
985372427 4:189300217-189300239 TTAATTCAATATATATTTATTGG - Intergenic
986223635 5:5792990-5793012 TTAATTCAACAAATATTTATTGG - Intergenic
986683556 5:10255454-10255476 TTCATTCAACAAATATTTATTGG + Intronic
987186117 5:15420773-15420795 TTTGTTCAACACATTTTTGTGGG + Intergenic
988269900 5:29000604-29000626 TTAGTTAAACAAGTATTTACAGG - Intergenic
989011102 5:36874711-36874733 TTCATTCAGCAAGTATTTATTGG - Intergenic
989109613 5:37894734-37894756 TTCATTCAAGAAGTATTTATTGG - Intergenic
989540466 5:42612118-42612140 TTCATTCAACAAGTATTTGTTGG - Intronic
991207869 5:64070413-64070435 TTCCTTCTACATGTATTTATTGG - Intergenic
991224311 5:64251714-64251736 TTAGTTCAAAAGTTTTTTATGGG - Intronic
991586394 5:68206453-68206475 TTAATTCAGAAAGTATTTATTGG + Intergenic
991627812 5:68622471-68622493 TTCATTCAACAAATATTTATTGG - Intergenic
992599174 5:78380594-78380616 TTTTTTCAAGAAGTATTTATTGG + Intronic
993416230 5:87636170-87636192 TGACTTGAAAACGTATTTATAGG - Intergenic
993701670 5:91126186-91126208 TTAATTCAACAAGAATTTACTGG - Intronic
993788958 5:92182998-92183020 TTAGGTCAACAAATATTTATTGG + Intergenic
993907951 5:93644147-93644169 CTACTTCAACGAGTATTTATTGG - Intronic
994668747 5:102740607-102740629 TTTATTCAACAAATATTTATTGG - Intergenic
994933406 5:106218654-106218676 TTTATTTAACACATATTTATGGG - Intergenic
996613032 5:125406850-125406872 TTAGGTCAACAAACATTTATTGG + Intergenic
997156476 5:131565684-131565706 TCAGTTGAACATGTATTTATGGG - Intronic
997926884 5:138038803-138038825 TTTATTCAACACATATTTCTTGG + Intronic
999637805 5:153640805-153640827 TAAATTCAACAGATATTTATTGG - Intronic
999690237 5:154140121-154140143 TTCATTCAACAAATATTTATTGG - Intronic
999983144 5:156977018-156977040 TGAGATCAATAAGTATTTATTGG - Intergenic
1000709902 5:164560111-164560133 TTATTTCCACACATATCTATGGG + Intergenic
1001609031 5:172984906-172984928 TTCACTCAACAGGTATTTATTGG - Intronic
1003103707 6:3197278-3197300 TTTATTCAACAAATATTTATGGG - Intergenic
1003983602 6:11413284-11413306 TTAGTTCAACAGTTATTCATGGG + Intergenic
1005455797 6:26018578-26018600 TTTATTCAACAAATATTTATGGG + Intergenic
1006678142 6:35778254-35778276 TTCATTCAACAAGCATTTATTGG - Intronic
1007355311 6:41310744-41310766 CTAGTTCAAAATGTATTTGTGGG - Intergenic
1007563179 6:42827524-42827546 TTCATTCAATATGTATTTATTGG + Intronic
1007901135 6:45414007-45414029 TTTGTTTATCATGTATTTATTGG - Intronic
1007943150 6:45800962-45800984 TTAATTCAACACATACTTTTTGG + Intergenic
1008331029 6:50244960-50244982 TTATTTTAAAACGCATTTATAGG - Intergenic
1008929993 6:56928893-56928915 TTAGTTCAACTCTTCTTTTTTGG - Intronic
1010985579 6:82420187-82420209 TTTATTCAACATATATTTATGGG + Intergenic
1011154908 6:84320135-84320157 TTAATTTACCAGGTATTTATTGG + Intergenic
1011177205 6:84576976-84576998 TTAGTTCAATTCCTGTTTATAGG + Intergenic
1011251454 6:85376373-85376395 TAAGTTGAAGACATATTTATTGG + Intergenic
1011631686 6:89332436-89332458 TTTATTCAACAATTATTTATTGG + Intronic
1011663049 6:89610615-89610637 TGTATTCAACACGTATTTAGTGG + Intronic
1011813626 6:91161786-91161808 TTAATTCAACACTCATTTATTGG - Intergenic
1012218866 6:96623567-96623589 TTAATTCAGAAAGTATTTATTGG - Intergenic
1012425595 6:99110819-99110841 TCAGTTCAGAAAGTATTTATTGG - Intergenic
1012454568 6:99390237-99390259 TTGGTTCAACATCTATTTAGTGG - Intronic
1012981900 6:105839923-105839945 TTCTTTCAACAAATATTTATTGG + Intergenic
1013046706 6:106492835-106492857 TTCATTCAACAAGCATTTATTGG - Intergenic
1014581248 6:123140137-123140159 TTCAGTCAACAAGTATTTATGGG - Intergenic
1015108802 6:129568625-129568647 TTCATTCAACAAATATTTATTGG - Intergenic
1015210731 6:130695472-130695494 TTCATTCAACAAATATTTATTGG - Intergenic
1015335573 6:132033923-132033945 TTAATTCAACAAGTATATATTGG - Intergenic
1015686862 6:135873885-135873907 TTCATTCAACAAATATTTATTGG + Intronic
1016026989 6:139297738-139297760 TTATTTAAACACATAATTATTGG - Intergenic
1016381262 6:143483762-143483784 TCAATTCAACAAGTATGTATTGG + Intronic
1016432019 6:143995547-143995569 TTTATTCAACAAATATTTATAGG - Intronic
1016445023 6:144122799-144122821 TTAGTTCAACAGCTTTTTCTTGG + Intergenic
1017543546 6:155427399-155427421 TTAGTTTGACAAATATTTATTGG - Intronic
1019231294 6:170566441-170566463 TTACTTCATTACGTATTGATAGG + Intronic
1020510867 7:9055355-9055377 TTAGTTGACCACGTATGTGTGGG + Intergenic
1020682651 7:11256081-11256103 TTTGTTTAACACGTACTTTTGGG - Intergenic
1021161355 7:17276980-17277002 TTTATTCAACAAATATTTATTGG + Intergenic
1021496860 7:21284525-21284547 TTTATTCAACAGATATTTATTGG + Intergenic
1021571341 7:22068302-22068324 TTTATTCAACATTTATTTATTGG - Intergenic
1021797550 7:24272291-24272313 TTTGATCAATACATATTTATTGG + Intergenic
1021824800 7:24538929-24538951 TTAGCTCAACAAGTATTTATTGG - Intergenic
1021845546 7:24758930-24758952 TTAATTCAACAATTATTTACTGG - Intergenic
1021914405 7:25417132-25417154 TTTCTTCAACAAGTATTTCTTGG - Intergenic
1021941066 7:25679420-25679442 TTGGTGCAACACCAATTTATGGG - Intergenic
1022744491 7:33156654-33156676 TTCATTCAACAAGTATTTACTGG - Intronic
1023575713 7:41624093-41624115 TTAATTCAACATATATTTATTGG - Intergenic
1025102236 7:56145200-56145222 TTAGTTAATCAAATATTTATAGG + Intergenic
1026732137 7:72921250-72921272 TTGGTTGAACATTTATTTATGGG - Intronic
1027111830 7:75446113-75446135 TTGGTTAAACATTTATTTATGGG + Intronic
1027284060 7:76630644-76630666 TTGGTTAAACATTTATTTATGGG + Intergenic
1028294842 7:89115866-89115888 TTAATTAATCACGTATTTAAAGG + Intronic
1028612726 7:92730437-92730459 TTAATTCAACATGTTCTTATTGG - Intronic
1028928890 7:96390988-96391010 TTTATTCAACAAATATTTATTGG - Intergenic
1029014301 7:97298953-97298975 TCTGTCCAACAAGTATTTATTGG - Intergenic
1030060354 7:105616574-105616596 TCATTGCAACAAGTATTTATGGG - Intronic
1030655062 7:112158340-112158362 TTTGTTCAAAAAGTATTTATTGG - Intronic
1030876202 7:114816556-114816578 TTAATTCAACAAATATTTAGTGG - Intergenic
1030934892 7:115573472-115573494 TTAGTTCAACAAATATTGGTTGG + Intergenic
1031269141 7:119623135-119623157 TTTATTCAACAAATATTTATAGG + Intergenic
1031637980 7:124124736-124124758 TTATTTTAACACACATTTATTGG + Intergenic
1031858607 7:126952352-126952374 TTCTTTCAACATGTATTAATTGG - Intronic
1033415864 7:141160830-141160852 TAAATTCAACACATTTTTATTGG + Intronic
1034124867 7:148662437-148662459 TTTATTCAACAAGTATTGATTGG + Intergenic
1037186210 8:16066586-16066608 TTTATTCAACACATATTTATTGG + Intergenic
1038022566 8:23562488-23562510 TTCATTCAACAAATATTTATTGG + Intronic
1038083581 8:24168434-24168456 TAAGTTCAACACTTCTTTTTGGG - Intergenic
1038084426 8:24178605-24178627 TTAGTTCAACACTTGGTTGTTGG - Intergenic
1038231926 8:25708673-25708695 TTAGTTCAAACAGTATTTAAAGG - Intergenic
1038973506 8:32664843-32664865 TTTATTCAACATGTATTTATTGG + Intronic
1039155276 8:34548698-34548720 TTAGTTGACCACATATATATTGG + Intergenic
1039399580 8:37257910-37257932 TTCATTCAACAACTATTTATTGG - Intergenic
1041384850 8:57289951-57289973 TTATTTCAACAAAGATTTATTGG + Intergenic
1041574465 8:59378245-59378267 TTTCTTCAGCACGTATATATCGG + Intergenic
1042056966 8:64774331-64774353 TCAAGTCAACAAGTATTTATTGG - Intronic
1042640180 8:70925304-70925326 TTTATTCAACACATATTTATAGG - Intergenic
1042721359 8:71830233-71830255 TTAGTTCAGCACATATAAATTGG + Intronic
1043487673 8:80714301-80714323 TTCGTTCAACAAATATTTGTTGG - Intronic
1044153218 8:88808866-88808888 TTATTTCAACAAATATTTATCGG - Intergenic
1044261717 8:90132440-90132462 TTCATTCAACAGATATTTATTGG + Intergenic
1044886523 8:96784325-96784347 TATGTTCAAAAGGTATTTATTGG - Intronic
1045336722 8:101211209-101211231 TTCATTCAACAAATATTTATTGG - Intergenic
1046054225 8:109060146-109060168 TTAATTCAACAAATATTTATTGG - Intergenic
1047332924 8:123908593-123908615 TTAATTCAACAGGTTTTTTTTGG + Intronic
1047547322 8:125831402-125831424 TTTGTTCAACAAAGATTTATAGG - Intergenic
1047559862 8:125975099-125975121 TTCATTCAACAAATATTTATAGG - Intergenic
1048352319 8:133626030-133626052 TTTGTTCAACAAATATTTATTGG - Intergenic
1050261326 9:3843569-3843591 TTCATCCAACAAGTATTTATTGG + Intronic
1052694612 9:31860323-31860345 TTAGGTCTACATGTATTCATTGG + Intergenic
1052804280 9:32999084-32999106 TTTATTCAACAAGTATTGATTGG - Intronic
1055241633 9:74193316-74193338 TTGATTCAACAGTTATTTATTGG + Intergenic
1056046191 9:82719651-82719673 TTAATTCAACAAATATTTATTGG + Intergenic
1056247211 9:84707369-84707391 TGAATTCAATACGTCTTTATAGG - Intronic
1056487234 9:87071680-87071702 TTCATTCAACAAATATTTATTGG + Intergenic
1058026806 9:100149628-100149650 TTATTTCAACTCGTTTTGATTGG - Intronic
1058111246 9:101032603-101032625 TTCATTCAACAAATATTTATTGG - Intronic
1059536796 9:115088056-115088078 TCAGTTCAACAACTATTTCTTGG - Intronic
1059621036 9:116005974-116005996 TTTATTCAACAAGTAATTATAGG + Intergenic
1059825306 9:118021662-118021684 TTTATTCAACAAATATTTATTGG - Intergenic
1059938549 9:119335698-119335720 TTTGTTCAACAGGTACTTAATGG + Intronic
1059941448 9:119363967-119363989 TTTATTCAACAAATATTTATTGG - Intronic
1059999452 9:119944920-119944942 TTTGAACAACACATATTTATTGG - Intergenic
1060140148 9:121202294-121202316 TTCATTCAACGTGTATTTATGGG + Intronic
1060736432 9:126069311-126069333 TTTGTAAAACACTTATTTATTGG + Intergenic
1061827611 9:133271003-133271025 ATAGTTTAACACTTTTTTATTGG - Intronic
1062072160 9:134562058-134562080 TTAGTTTAACAAGTATTTACTGG + Intergenic
1186537579 X:10365695-10365717 TTAGTTCAGCAAACATTTATTGG + Intergenic
1186841206 X:13486358-13486380 TTTGTTCAACACATGTTAATTGG + Intergenic
1187020793 X:15379325-15379347 TTTTTTCAACAGGTATTTATTGG - Intronic
1187286337 X:17907594-17907616 TTAATTCAACAAGCATTTATTGG - Intergenic
1187714873 X:22092671-22092693 TCAATTCAAAACATATTTATTGG - Intronic
1188464005 X:30457631-30457653 TTTATTCAACAGCTATTTATTGG + Intergenic
1188706828 X:33344292-33344314 AAAGTTCAACATGTATTCATGGG - Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189536632 X:41941633-41941655 TCAGTTCAACTAGCATTTATTGG - Intergenic
1189634912 X:42996854-42996876 TTCATTCAATACTTATTTATTGG - Intergenic
1190746940 X:53329569-53329591 TCAGTTCAACAAACATTTATTGG + Intergenic
1191742484 X:64450547-64450569 TTCTTTCAACAAATATTTATTGG - Intergenic
1192024794 X:67438065-67438087 TTAATTCCACAAATATTTATTGG - Intergenic
1192355810 X:70402332-70402354 TTATTTCAACCAGTATTTAATGG + Intronic
1192372374 X:70525269-70525291 TTCTTTCAACAAATATTTATTGG + Intergenic
1192417874 X:71000329-71000351 TCTGTTCAACACTTATTCATTGG + Intergenic
1192421127 X:71032008-71032030 TTAGTTCTACACTTATTTGCTGG - Intergenic
1193864206 X:86709844-86709866 TTATTTCAACAGGTGTGTATGGG - Intronic
1194199472 X:90937221-90937243 GTTGTTCAACACATATTTGTTGG + Intergenic
1194254253 X:91617239-91617261 TTACCTTAACACTTATTTATTGG + Intergenic
1194622621 X:96191853-96191875 TTCATTCAACAAATATTTATTGG + Intergenic
1194675322 X:96787305-96787327 TTAGTTCAAAATCCATTTATTGG - Intronic
1194975030 X:100385999-100386021 TTAATTCAACAAACATTTATTGG + Intronic
1195155066 X:102114906-102114928 TTATTTCAACAGATATTTATTGG + Intergenic
1195239422 X:102936499-102936521 TTATTTCAACACATCTTTCTTGG + Intergenic
1195298282 X:103501554-103501576 TTATTTCAACACATCTTTGTTGG - Exonic
1195392586 X:104378401-104378423 TTCCTTCCACAAGTATTTATTGG + Intergenic
1195427505 X:104751225-104751247 TTTGTTCAGCAAATATTTATTGG + Intronic
1195755859 X:108198215-108198237 TCAGTTCAACAAGTATTTACTGG - Intronic
1195799612 X:108693065-108693087 TTAGTTTGACTCATATTTATTGG + Intronic
1196039810 X:111190002-111190024 TTCATTCAACAAATATTTATTGG + Intronic
1196112183 X:111958476-111958498 ATAATTCAATACATATTTATTGG - Intronic
1196135109 X:112200454-112200476 TTCATTCAACAAATATTTATTGG - Intergenic
1196675926 X:118420051-118420073 TAAGTTCCACAGGTATTTGTGGG - Intronic
1197733654 X:129833617-129833639 TTAGTCCAACAAGTACTTGTTGG - Intronic
1197896597 X:131322078-131322100 TTAGTTGAACAAACATTTATTGG + Intronic
1198385831 X:136128627-136128649 TTTATTCAACACATATTTATTGG - Intergenic
1198535738 X:137584332-137584354 TTTATTCAACACTCATTTATTGG - Intergenic
1199191179 X:144972957-144972979 TTAATTCAACAAATATTTATTGG - Intergenic
1199399552 X:147381268-147381290 TTCGTTCAACAAATATTCATTGG + Intergenic
1200385183 X:155883154-155883176 TCAGTTCAACACGTATATACTGG - Intronic
1200545465 Y:4513641-4513663 GTTGTTCAACACATATTTGTTGG + Intergenic
1200573044 Y:4856818-4856840 TTACCTTAACACTTATTTATTGG + Intergenic
1201464200 Y:14262278-14262300 TTAATTCAACAAATATTTACTGG - Intergenic