ID: 1125189844

View in Genome Browser
Species Human (GRCh38)
Location 15:36978041-36978063
Sequence TTTGATAAGCAGTTATTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125189841_1125189844 29 Left 1125189841 15:36977989-36978011 CCTCTAGAAAGGCACATGTTCTA 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1125189844 15:36978041-36978063 TTTGATAAGCAGTTATTTTCTGG 0: 1
1: 0
2: 3
3: 24
4: 332
1125189840_1125189844 30 Left 1125189840 15:36977988-36978010 CCCTCTAGAAAGGCACATGTTCT 0: 1
1: 0
2: 0
3: 3
4: 169
Right 1125189844 15:36978041-36978063 TTTGATAAGCAGTTATTTTCTGG 0: 1
1: 0
2: 3
3: 24
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125189844 Original CRISPR TTTGATAAGCAGTTATTTTC TGG Intronic
901899213 1:12343927-12343949 TTTAACAAGCAGCTAGTTTCAGG + Intronic
902359121 1:15932445-15932467 TTTGATTTGGAGTTTTTTTCAGG - Exonic
904545276 1:31265497-31265519 TCTGATGAGCAGTTTGTTTCTGG - Intronic
904633865 1:31864427-31864449 TTAGATAAGAAGGTAGTTTCAGG + Intergenic
906424446 1:45698459-45698481 TTTGAGAAGCAGTTTTGTTTGGG + Intronic
906749800 1:48248598-48248620 ATTGAACAGCTGTTATTTTCTGG - Exonic
907052844 1:51341369-51341391 TTTGAGAGGCAGAAATTTTCAGG + Intronic
907185898 1:52608860-52608882 ATTGATAACAAGTTATTTTTTGG - Exonic
907858187 1:58324569-58324591 TTGGAAAAGCAGCCATTTTCTGG + Intronic
909105346 1:71399250-71399272 TTGAATAAGCAATTTTTTTCTGG - Exonic
909193057 1:72579100-72579122 TTTGATAAGAAAATATTTTAAGG + Intergenic
911311567 1:96298083-96298105 TTTGAAGACCAGTTATTTTTTGG - Intergenic
911463312 1:98218071-98218093 AATAATAAGCAGTTATTTTGTGG + Intergenic
912197783 1:107419736-107419758 TTTGCTTAGCAGCTATTTCCTGG - Intronic
913570830 1:120118695-120118717 TGTGATAAGTTGTTCTTTTCTGG - Intergenic
914291635 1:146279671-146279693 TGTGATAAGTTGTTCTTTTCTGG - Intergenic
914552679 1:148730454-148730476 TGTGATAAGTTGTTCTTTTCTGG - Intergenic
915796590 1:158741564-158741586 TTTTATAAGATGTTTTTTTCTGG - Intergenic
915877149 1:159623252-159623274 TTTCATATGCACATATTTTCAGG - Intergenic
916607998 1:166362041-166362063 TTGGATTAGCAATTTTTTTCAGG - Intergenic
916866752 1:168868167-168868189 TCAGATAAGCAGTTAATTTGTGG + Intergenic
917428103 1:174936721-174936743 TTTCATAAGCAAATATTTACTGG - Intronic
918515234 1:185356302-185356324 TTTAATAAGTAGACATTTTCTGG - Intergenic
919496716 1:198281570-198281592 TTTGGAAAGGAGGTATTTTCAGG + Intronic
919614134 1:199784201-199784223 TGTGATAAGCATTGATTATCTGG + Intergenic
920601857 1:207333633-207333655 CTTGTTAATCAGTTATTTTAAGG - Intronic
922382563 1:225046984-225047006 TTGGAGAAACAGTTAATTTCAGG - Intronic
923245334 1:232124888-232124910 TTTGATAATTTGTTTTTTTCTGG + Intergenic
923882399 1:238117825-238117847 GTTGACAAGCATTTACTTTCTGG + Intergenic
924599047 1:245472133-245472155 TTTGACTGGCAGGTATTTTCTGG - Intronic
1064113131 10:12555624-12555646 TTGGAGAAGAAGTTATTTGCTGG + Intronic
1064625469 10:17257217-17257239 TTTTATATGCAACTATTTTCTGG - Intergenic
1065643801 10:27813943-27813965 TTGGATAAGCAGTTGTTCTGGGG - Intronic
1065779275 10:29151632-29151654 TTTGATAAGCAGTATCCTTCAGG - Intergenic
1066224288 10:33367163-33367185 TTTAAGTAACAGTTATTTTCTGG - Intergenic
1067021549 10:42804137-42804159 GTTGATAAACAATTATTTCCAGG + Intronic
1067921337 10:50461151-50461173 TATGATAATCAGTTATTTGTTGG - Intronic
1068318940 10:55384098-55384120 TTTTATATGCAGTTATTCCCTGG - Intronic
1068591148 10:58854524-58854546 CTTGAGAAGCACTTATTTACAGG - Intergenic
1068820328 10:61368860-61368882 TTTGATAAACATTTATTTTCTGG - Intergenic
1069179423 10:65339047-65339069 TTTAATACGGATTTATTTTCAGG - Intergenic
1071455769 10:85850391-85850413 TCTGATAAGATTTTATTTTCAGG - Intronic
1072776360 10:98199338-98199360 ATTGATAAGCAGATATTTATTGG - Intronic
1076209819 10:128631334-128631356 TTTAATTTGAAGTTATTTTCTGG + Intergenic
1078567880 11:12432622-12432644 CCAGATAAGCAGTTATTTTTTGG - Intronic
1079833599 11:25302490-25302512 TTTCTTAAGCATTTATTTTAGGG - Intergenic
1079950301 11:26793648-26793670 TTTGATAAGCATTTATTACCAGG + Intergenic
1080835792 11:35939721-35939743 TCTGACAAACAGTTATTGTCTGG - Intergenic
1084386653 11:68847137-68847159 TTGGAGAAGCAGTCATATTCTGG + Intergenic
1085100034 11:73792971-73792993 TTTGATCAGCAGATATTTATTGG + Intronic
1085425983 11:76405035-76405057 TTAAATAAGTAGTTATTTTCTGG + Exonic
1085845956 11:80065030-80065052 TTTGAAAAGCTGTCATGTTCAGG - Intergenic
1086887068 11:92218446-92218468 TTTGATAACTAATTATTTACAGG + Intergenic
1087797055 11:102465420-102465442 GTTGAAAAGCATGTATTTTCGGG - Intronic
1087996345 11:104814009-104814031 TATGATAAGTAGTTGTATTCTGG + Intergenic
1089772088 11:120810299-120810321 TTCTATAAGAATTTATTTTCAGG + Intronic
1091366484 11:135025163-135025185 TTTAATCAGCAGATTTTTTCTGG + Intergenic
1093274821 12:17111932-17111954 TCTGAAAAACAGATATTTTCAGG - Intergenic
1093325002 12:17762824-17762846 TTTGACAGGTCGTTATTTTCTGG - Intergenic
1093427864 12:19049371-19049393 TTTAATTAGCAAGTATTTTCTGG - Intergenic
1093846812 12:23982185-23982207 TATGATAAGCAGATAGTTTATGG - Intergenic
1094269786 12:28600420-28600442 TTTTATTATCAGTTATTTTCAGG + Intergenic
1095552805 12:43463750-43463772 TTCAATAAGCATTTATTTTGTGG + Intronic
1095859100 12:46895089-46895111 TTTGAAAAAAAGTTATTTTTTGG - Intergenic
1096119463 12:49078306-49078328 TTAGCTAATAAGTTATTTTCAGG + Intergenic
1096443775 12:51669674-51669696 TTGGATAAGAAGTTGGTTTCAGG + Intronic
1098279810 12:68851128-68851150 TTGCATAAGTACTTATTTTCAGG + Intronic
1098408553 12:70153613-70153635 TTTGATAGCCTGTGATTTTCAGG - Intergenic
1098768219 12:74517127-74517149 TTTTTTAAGCACTCATTTTCTGG - Intergenic
1099391203 12:82081482-82081504 TTTGAAAATCAGTTATCTTAAGG + Intergenic
1100354270 12:93814296-93814318 TGAGATAAGCAGTTTTTTTGTGG + Intronic
1101200334 12:102428837-102428859 TGTGATATTCACTTATTTTCAGG + Intronic
1101416384 12:104512236-104512258 TATCAGAAGCAGTAATTTTCTGG + Intronic
1101486458 12:105167330-105167352 TTTGTTAAGCATGTATTTACTGG - Exonic
1102169156 12:110829013-110829035 TTTGATCAGCTTTTATTTTCTGG + Intergenic
1103197781 12:119060208-119060230 ATTAATATGCAGGTATTTTCAGG - Intronic
1105483833 13:20806097-20806119 TTTAAAAAGCAGTTCATTTCAGG - Intronic
1105666474 13:22563633-22563655 TTGGAAAAGCAGATATTATCAGG + Intergenic
1105906989 13:24821804-24821826 TTTGATTTGCATTTTTTTTCTGG + Intronic
1106266147 13:28112040-28112062 TCTGGTAAGGAGGTATTTTCAGG + Intergenic
1106768800 13:32942139-32942161 TCTGATAAGGAGTTAATATCTGG + Intergenic
1106823638 13:33493687-33493709 TTTAAAAAGTAGCTATTTTCTGG + Intergenic
1108690694 13:52856896-52856918 CTTTAGAAGCATTTATTTTCAGG + Intergenic
1108744258 13:53374831-53374853 TTTTGTAAGTAGATATTTTCTGG + Intergenic
1108773142 13:53730399-53730421 TTTGTAAAGCAGAAATTTTCAGG + Intergenic
1109785405 13:67168115-67168137 TTGGATAACAAGTGATTTTCTGG - Intronic
1110116681 13:71826241-71826263 TTTGATAAGCACTGAATTTTAGG + Intronic
1111179858 13:84650367-84650389 ATTGAAAAGCAGTGATTCTCTGG - Intergenic
1111730581 13:92071439-92071461 TTCTATAAGCAATTATTTTAAGG + Intronic
1111895034 13:94131208-94131230 TGTGATAAGTATATATTTTCTGG + Intronic
1112225414 13:97534915-97534937 TTTTCTCAGTAGTTATTTTCAGG - Intergenic
1114136953 14:19863680-19863702 TTTGATATGCCATTTTTTTCTGG - Intergenic
1114999299 14:28401785-28401807 TTTCAGAAGCGGCTATTTTCTGG + Intergenic
1115100890 14:29697893-29697915 TTTGAATAGCATTTATTCTCAGG - Intronic
1115510644 14:34134843-34134865 TTTGTTAACCAGTTATTATTTGG + Intronic
1116170978 14:41402100-41402122 TTTGAACAGCAGTTATTCACGGG - Intergenic
1116254784 14:42538251-42538273 TTGGATAAGCAGATATATGCTGG + Intergenic
1117077633 14:52120493-52120515 TTTTATATGCAATTATTTTTTGG + Intergenic
1117406597 14:55410228-55410250 TTGAATAAGCAGCTGTTTTCTGG + Intronic
1117802585 14:59460289-59460311 GTTTCTGAGCAGTTATTTTCTGG - Intronic
1117946676 14:61032837-61032859 ATTGATAAGCTTTTATTTTAGGG + Intronic
1118706690 14:68486686-68486708 TTTAACAAGCAGTTTTTGTCTGG - Intronic
1119755226 14:77113025-77113047 TTTAATCAAAAGTTATTTTCAGG + Intronic
1120114980 14:80604843-80604865 TTTCAAAAGTAGTTATCTTCTGG + Intronic
1120460225 14:84785839-84785861 TTAGGCAAGCAGTTATTTGCAGG + Intergenic
1120886877 14:89458651-89458673 TTTGGTAATCATTTGTTTTCAGG - Intronic
1121049565 14:90811626-90811648 TTTGGTAAGCAAATGTTTTCAGG - Intronic
1124909052 15:33900323-33900345 TTTGAGACAAAGTTATTTTCTGG + Intronic
1124957665 15:34370260-34370282 TTTGATAATCAAATATTTGCCGG + Intergenic
1125189844 15:36978041-36978063 TTTGATAAGCAGTTATTTTCTGG + Intronic
1126340678 15:47637647-47637669 TTTTGGAAGTAGTTATTTTCAGG + Intronic
1126413002 15:48391205-48391227 TCTAATAAGTAGTTATTTTAAGG - Intergenic
1126432019 15:48596411-48596433 CTTCATTAGCATTTATTTTCAGG - Intronic
1126731217 15:51685045-51685067 TTTAATAGTCAGTTGTTTTCTGG - Intronic
1127649969 15:60997550-60997572 TTTGAGAAGCAGCCATTCTCAGG - Intronic
1128719595 15:69938589-69938611 TTTGAGAAACAATTATTTTGGGG - Intergenic
1129135200 15:73542892-73542914 TTTCATAAGGATTTATTTACAGG + Intronic
1130932787 15:88441976-88441998 TTGGATAAGCAGTTCCTTTGTGG - Intergenic
1133526962 16:6615136-6615158 TTTGCAAAACAGTTATTTTGTGG + Intronic
1133679960 16:8112076-8112098 TATGATAAACAGTTATTTCTTGG - Intergenic
1134622741 16:15701722-15701744 TTTGTTACTAAGTTATTTTCTGG + Intronic
1134802004 16:17093265-17093287 TTAGATAACAAATTATTTTCTGG - Intergenic
1135671604 16:24380417-24380439 TTTGATAAGAAGTTAATCTCAGG + Intergenic
1138967042 16:62096966-62096988 TTTGAAAAGAAATTATTTTTAGG - Intergenic
1139501225 16:67367750-67367772 TTTCAGAAGAAGTTAGTTTCAGG + Intronic
1140040267 16:71402831-71402853 TTTGACAAGCAGCAAGTTTCCGG - Intergenic
1140612215 16:76613804-76613826 AATGTTGAGCAGTTATTTTCTGG - Intronic
1140715686 16:77723421-77723443 TTAGATAAGCAGTTGTTTGCAGG - Intronic
1142488061 17:259567-259589 ATTGAAAATCAGTTACTTTCTGG + Intronic
1143902920 17:10187858-10187880 TTTGAAAAGTAATTCTTTTCTGG + Intronic
1144102860 17:11959646-11959668 TTTGATGAGCAAGTTTTTTCTGG - Intronic
1146510847 17:33447042-33447064 TTTGTTTAGCTGTTATTCTCAGG - Intronic
1146970404 17:37067385-37067407 TTTAATATGCAGATATTTTAGGG + Intergenic
1149718894 17:58822705-58822727 TTTAATAGGTAGTTTTTTTCTGG + Intronic
1150172903 17:63018736-63018758 ATGGATTAGCAGTTATTATCAGG - Intronic
1150547825 17:66179862-66179884 TTTGATACCCAGTTTTTTTTAGG + Intronic
1152669852 17:81596725-81596747 TTTATAAAGCAGTGATTTTCAGG - Intronic
1152854604 17:82657542-82657564 TTACAAAAGCAGTTATTTTAAGG + Exonic
1154044234 18:10889373-10889395 TTTGATAATGAATTATTTTAAGG + Intronic
1155034453 18:22013885-22013907 TCTGGAAAGAAGTTATTTTCTGG + Intergenic
1155192502 18:23442789-23442811 TTTGATAAGCAGTTTACTTAGGG - Intergenic
1155269978 18:24131266-24131288 TTTGATAATCATTAATTTTAAGG + Intronic
1155280141 18:24230872-24230894 CTTGATAAGCACTTATTTGTGGG + Intronic
1155814089 18:30282323-30282345 TCTGATAGGCAGTTATCTTCTGG - Intergenic
1157135972 18:45055964-45055986 TTCCAAAAGCAGTTACTTTCTGG + Intronic
1158033868 18:53000742-53000764 TTTCATGAGCTGTTATTATCTGG - Intronic
1158035391 18:53022762-53022784 CTTGATAAGCCTTTCTTTTCTGG + Intronic
1158055560 18:53275913-53275935 TTTAACAAACAGTTATTTTCAGG + Intronic
1159133736 18:64311079-64311101 TTTGACAATCATTTATTCTCTGG - Intergenic
1159139009 18:64369829-64369851 TTTCAGAAGCGGCTATTTTCTGG + Intergenic
1159476417 18:68925854-68925876 TCTAATAAGCAGTTATTTTGAGG + Intronic
1162241872 19:9361875-9361897 GTTTATAGGCAGTTATTTTATGG + Intronic
1163132100 19:15280782-15280804 TTGAATAAACAATTATTTTCAGG + Intronic
1164046276 19:21544867-21544889 TTTGCTAAGCAGGTATATTCAGG - Intronic
1164450609 19:28360411-28360433 TTTGAAAAAAAGTTTTTTTCTGG - Intergenic
1165870599 19:38970176-38970198 TTTGATAATCATTCATGTTCTGG - Intronic
1167807405 19:51798034-51798056 TTTGATAAAGACTGATTTTCAGG - Intronic
925454677 2:4005468-4005490 TCTGAAAAGGAGTGATTTTCTGG - Intergenic
926480368 2:13385369-13385391 AATGATATGCAGTTATGTTCAGG + Intergenic
928012845 2:27627139-27627161 TTTGAGTAGCCGTTAGTTTCTGG + Exonic
929590505 2:43142769-43142791 CTTGATAAGCAGTGATTCTGAGG - Intergenic
930346945 2:50195125-50195147 ATTGGTCAGCAGTTCTTTTCTGG + Intronic
930802213 2:55454692-55454714 ATTGATAAACAGCAATTTTCTGG - Intergenic
930863773 2:56103107-56103129 TTAAATAAGCAGTTGCTTTCTGG + Intergenic
932067401 2:68580427-68580449 TTTTAAAAGCAAATATTTTCTGG + Intronic
932555623 2:72822659-72822681 TTTGAAGAGCAGGTATTTTAGGG + Intronic
933405092 2:81847840-81847862 TTTGATAAACTCATATTTTCTGG + Intergenic
936722151 2:115265365-115265387 TTTAATAAACAGTTATTATTAGG + Intronic
937964715 2:127495030-127495052 TTTGAAAAACTGTTATTTTAAGG - Intronic
938009563 2:127818137-127818159 TTAGAAAAGAAGTTATTTTGGGG - Intergenic
938592899 2:132756587-132756609 TTTTAAAAGAACTTATTTTCTGG - Intronic
938643247 2:133304432-133304454 TTGAATAAACATTTATTTTCAGG + Intronic
938643462 2:133307296-133307318 TTTGACAAACTGATATTTTCTGG - Intronic
939202281 2:139052651-139052673 ATTGAAAAGCAGTTTTTTACAGG - Intergenic
939362901 2:141196832-141196854 TTTCATAAGCAGTAAGTCTCAGG - Intronic
941126230 2:161586898-161586920 TTTTACAATCAGTTATTTTTGGG + Intronic
941475099 2:165941563-165941585 TTTTTTAAGAAATTATTTTCAGG + Intronic
942129853 2:172867267-172867289 TTTAATAAGCAGTTTTTGGCTGG - Intronic
942876061 2:180799857-180799879 TTTGCTAAGCATTTAACTTCTGG - Intergenic
942905464 2:181174946-181174968 TATGACTAGCAGTTATTTTCTGG + Intergenic
943296839 2:186151051-186151073 TTAGCTAAGCAGTTATTTGCAGG - Intergenic
944537691 2:200727463-200727485 TTTGATGACCAGTTACTTTTAGG + Intergenic
945354555 2:208823774-208823796 TTTGATATGCAGTAATTATTTGG - Intronic
946534704 2:220613832-220613854 TGTAAAAAGCAGTTATTTTTCGG - Intergenic
947409889 2:229825813-229825835 TTTGATAGCCTCTTATTTTCTGG - Intronic
948420207 2:237854638-237854660 TTTTTTAAGTACTTATTTTCTGG + Intergenic
1169475419 20:5926774-5926796 TTTGGTAAAGAGTTATTCTCTGG + Intergenic
1171320362 20:24238255-24238277 TTTTCTAAGCAGTTGTTTTCTGG + Intergenic
1174926262 20:54763250-54763272 TTTAATAAGTAGGTATTTTGTGG + Intergenic
1176699490 21:10026230-10026252 TTGGATAAGCAGTTCTTAACCGG + Intergenic
1177813365 21:25949079-25949101 TTTTTTAAAAAGTTATTTTCAGG - Intronic
1178507660 21:33176211-33176233 TGTGAGAAGCAGTCATATTCTGG - Intergenic
1179027198 21:37689184-37689206 TTTCAAAAGCAGTCACTTTCTGG + Intronic
1180223521 21:46375470-46375492 TTTCAAAAAAAGTTATTTTCAGG - Intronic
1182492287 22:30681295-30681317 TTTGATAAGCCTGGATTTTCTGG - Intergenic
949729114 3:7087264-7087286 TAAGATAAACATTTATTTTCAGG - Intronic
949755293 3:7402621-7402643 TTTTATATGCAGGTATTTTCAGG - Intronic
950206088 3:11082266-11082288 TTTGTTAACAAGTTATTTTGGGG - Intergenic
950761193 3:15229037-15229059 TTTAATAAGAAGTTAATTACCGG + Exonic
951428036 3:22571904-22571926 TATAATAAGCAGTTACTTTAAGG + Intergenic
955007637 3:54984478-54984500 TTTGGAAAGCAATTGTTTTCAGG - Intronic
955037136 3:55279767-55279789 TTAGAAAAAAAGTTATTTTCTGG + Intergenic
956350207 3:68326699-68326721 TTTGAAAAGCCCTTATTATCAGG + Intronic
957114457 3:76007445-76007467 TTCGATAAGCAGTTATTTTTAGG - Intronic
957597050 3:82279904-82279926 TTTGATTTGCAGTGATTTTGAGG + Intergenic
959416471 3:106081245-106081267 TTTATAAAGCAGTTATTTTGGGG + Intergenic
959781283 3:110236642-110236664 TATGATAAACAGATGTTTTCAGG + Intergenic
960214316 3:115011992-115012014 TCTTATAAGCAATTATTTTAAGG - Intronic
960225574 3:115164413-115164435 TCTGATTAGCACTAATTTTCTGG + Intergenic
960594216 3:119393116-119393138 TCTGATAAGCACTTTTGTTCTGG - Intronic
960657131 3:120017475-120017497 TTGGATAAGCTGTTATATTGGGG - Intronic
961264502 3:125630924-125630946 TTTAATAAACATTTATTTTTGGG + Intergenic
962042971 3:131726449-131726471 TTTCCTGAGCAGTTATATTCAGG - Intronic
963219068 3:142786377-142786399 TTTGAAAATCAGTTAATTTCAGG + Intronic
963526154 3:146416424-146416446 TTTTATAACAAGTTATATTCTGG + Intronic
964623394 3:158736691-158736713 TTTTATAAACAGGGATTTTCTGG + Intronic
965455002 3:168888760-168888782 TGTGATAAGTAGTTAATTTAAGG - Intergenic
965576112 3:170220439-170220461 ATGGATATGCAGTTACTTTCAGG + Intergenic
966656883 3:182368761-182368783 TTTGATAAGGCTTTATTTTATGG - Intergenic
967784132 3:193471632-193471654 TTTGCTATACAGTTATTTGCTGG - Intronic
967843810 3:194028994-194029016 TTTGTTCAGCATTTATTTTGAGG + Intergenic
970531147 4:16985792-16985814 TGTGATAAGCAAAGATTTTCTGG + Intergenic
972479312 4:39482946-39482968 TTTAATAGGCATTTATTTTACGG - Intergenic
972717431 4:41661337-41661359 TTTTTTAAGCAGTAATTTTTAGG - Intronic
973607077 4:52598775-52598797 CTTTATAAGCAGTGATTCTCTGG + Intronic
974233083 4:59142957-59142979 TTTGAGAAGCTGATAATTTCTGG - Intergenic
974260046 4:59515772-59515794 TTTGATATGTACTCATTTTCAGG + Intergenic
974765849 4:66344951-66344973 TTTAAGAAGCACTTATTTCCTGG + Intergenic
976844291 4:89470099-89470121 TTTGGTAAGCAGTTATGTGACGG - Intergenic
978387898 4:108194105-108194127 CTTGATCAGATGTTATTTTCAGG + Intergenic
980371900 4:131884864-131884886 TTGGATAAGCAGTTCTTAACCGG + Intergenic
980437501 4:132797439-132797461 TCTGATTAGCACTTTTTTTCAGG - Intergenic
984035847 4:174666842-174666864 TCTGAGAAGCAGTCATGTTCAGG + Intronic
985477626 5:87913-87935 TATGTTAAGCATTTATTTCCAGG + Intergenic
985963096 5:3318382-3318404 TTTGAGAGACAGTTATTTGCTGG - Intergenic
986158695 5:5203088-5203110 AATGATAAACATTTATTTTCAGG + Intronic
986585464 5:9312287-9312309 ATTGAAAACCAGTCATTTTCAGG - Intronic
986895446 5:12360830-12360852 TTTGATAAGCAGTCACCTTCTGG + Intergenic
987465987 5:18272713-18272735 TTCGATAAGCATCTACTTTCTGG + Intergenic
987580280 5:19781945-19781967 CTTTATAATCATTTATTTTCTGG + Intronic
987705443 5:21458190-21458212 TAATATAAACAGTTATTTTCAGG + Intergenic
989497797 5:42129658-42129680 TTTGATAAGCAATTGATTTCTGG + Intergenic
989782104 5:45279901-45279923 TTTGTAAAGAAGTTATTTGCAGG + Intronic
990078418 5:51880791-51880813 TTTGATAAATAGATAGTTTCAGG - Intergenic
990161076 5:52941257-52941279 TTTGGTAAACAGTTTCTTTCGGG + Intronic
990717910 5:58659402-58659424 TTGGATGACCAGTTATTTGCAGG + Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
990850191 5:60194472-60194494 TTTGATATGCAGTCATGTTTGGG - Intronic
991235499 5:64390435-64390457 TATGATAAGGAGTAATTTTCTGG + Intergenic
992095079 5:73355557-73355579 TTTGATTACCAATGATTTTCAGG + Intergenic
993680822 5:90875327-90875349 CTTTATAAGCATTTCTTTTCTGG - Intronic
995310132 5:110701052-110701074 TTTGATAGGAAGAGATTTTCTGG + Intronic
995438819 5:112167143-112167165 ATTAATAAGCAGTTATCTTTCGG - Intronic
995646328 5:114316656-114316678 TTTCATATGCATTTATTTTGGGG - Intergenic
995821758 5:116242576-116242598 TTTGAAAAGCAGCCAGTTTCTGG + Intronic
996512784 5:124335985-124336007 TTTGATATGCAAATATTTCCAGG + Intergenic
996734502 5:126746398-126746420 CTAGATAAAGAGTTATTTTCAGG + Intergenic
998648883 5:144094958-144094980 TATGATAAGCAGTTGATTTGAGG - Intergenic
998805818 5:145917075-145917097 TTTGAAAAGCAGTTATTTCCAGG + Intergenic
999138663 5:149341932-149341954 TTTCTTATGCAGTTATTTTGGGG + Intergenic
999872182 5:155764346-155764368 TTTGACAAGCATTTATTATCAGG + Intergenic
1000904555 5:166948752-166948774 TTTGATAATGAGTAATTTTGGGG - Intergenic
1001232934 5:170005314-170005336 ATTGATAAACAAATATTTTCTGG + Intronic
1001470544 5:172009025-172009047 TTTGATAAGCATTTGTTCACTGG - Intergenic
1001918315 5:175580445-175580467 AATGGTAAGCAGTTATTTTCAGG + Intergenic
1003709428 6:8572548-8572570 TTTGATGTGCAGTTTTTTTAAGG - Intergenic
1004216130 6:13705984-13706006 TTAGATAAGCAATTATATTTAGG + Intronic
1004249015 6:14007109-14007131 TCTGATAAGCAGTTATTACTTGG - Intergenic
1004966848 6:20861718-20861740 TTTGATAAGCACTTGTGTGCTGG + Intronic
1004972383 6:20924981-20925003 TTTGAAAAGCAGTTCTGTTGTGG + Intronic
1006095640 6:31654771-31654793 TTTGCAAAGCACTTAGTTTCTGG - Intronic
1006721442 6:36154807-36154829 TCTGAAGAGCATTTATTTTCAGG - Intergenic
1008984862 6:57530196-57530218 TTTGAGAACCACTTACTTTCTGG - Intronic
1009036772 6:58126581-58126603 TTTAATTAGCATTTTTTTTCAGG + Intergenic
1010605343 6:77883011-77883033 CGTTATAAGCAATTATTTTCTGG - Intronic
1011618302 6:89218371-89218393 TTTGAAATGCAGTTGTTTTAAGG + Intronic
1011647468 6:89473522-89473544 TTTGGTATGCAGAAATTTTCTGG - Intronic
1015176560 6:130315927-130315949 TGTGCTAAGGAGTGATTTTCTGG + Intronic
1015736506 6:136405789-136405811 TGTGAGAAGTAGTTACTTTCTGG + Intronic
1016154113 6:140782250-140782272 CTAGATATGCAGATATTTTCTGG - Intergenic
1016161475 6:140885739-140885761 CTTGAAAAGCTCTTATTTTCAGG + Intergenic
1016506755 6:144790416-144790438 TTTTAAAAGCTTTTATTTTCTGG + Intronic
1016710199 6:147162479-147162501 TATAATAAGCAGTTATACTCTGG - Intergenic
1016717983 6:147255906-147255928 CATGATAAGCAGGTATTTTTTGG + Intronic
1016773545 6:147879013-147879035 TTTGGAATGCAGTTATTTTAAGG + Intergenic
1020048894 7:5067878-5067900 TTTGATAAAAAGTTATTTGGAGG + Exonic
1020141946 7:5616738-5616760 TGTGATCAGCAGTTATCTTTGGG + Intergenic
1021194222 7:17656871-17656893 TCTGATAAGGAGTTAATATCCGG + Intergenic
1022019790 7:26387346-26387368 TTTGATAAACCGTTATTGTTTGG + Intergenic
1022042746 7:26595928-26595950 TTTGATAAGCATTTGTTGGCAGG + Intergenic
1022361224 7:29660135-29660157 TTTAAAAAGCACGTATTTTCAGG - Intergenic
1022700585 7:32755566-32755588 TTTAAAAAGCACGTATTTTCAGG + Intergenic
1023129000 7:36983823-36983845 TTTGATAATCAGGCATTTTAGGG - Intronic
1023192993 7:37603066-37603088 ATTGATAAACATCTATTTTCTGG - Intergenic
1023196544 7:37646023-37646045 TTTCAGAATCAGCTATTTTCAGG - Intergenic
1024249367 7:47494824-47494846 TTTGTAAAGCAGTTAATTTTAGG - Intronic
1026383868 7:69826151-69826173 TTTGATAATTTGTTATTTTTTGG + Intronic
1027982500 7:85243743-85243765 TTTGACTTGCAGTTCTTTTCAGG + Intergenic
1028044755 7:86104321-86104343 TTTTATAATTAGTTTTTTTCAGG - Intergenic
1028154476 7:87414142-87414164 TTTTATAAGAAGTTATACTCAGG - Intronic
1028317860 7:89426640-89426662 TTTGAAAAACAGTTATTTACAGG + Intergenic
1028743225 7:94300118-94300140 TTTGACATGCAGAAATTTTCTGG - Intergenic
1030461877 7:109848820-109848842 TTTGAGAAGCATTTATCTTCTGG + Intergenic
1031326429 7:120404747-120404769 TTTGATTAGCACTGATTTTTGGG + Intronic
1031712879 7:125071301-125071323 CTTGAAAAGCAGGTAGTTTCTGG + Intergenic
1032484100 7:132270154-132270176 ATTAATAAGCATTTATTTTATGG - Intronic
1032993347 7:137418261-137418283 TTTAAAAAGCAGTTCTTTTGAGG + Intronic
1033188726 7:139255784-139255806 CTTCAAAAGCATTTATTTTCAGG - Intronic
1036344400 8:7948833-7948855 TTTTATAAGCAGTTATGTAGAGG + Intronic
1036839741 8:12109604-12109626 TTTTATAAGCAGTTATGTAGAGG + Intronic
1036861532 8:12355844-12355866 TTTTATAAGCAGTTATGTAGAGG + Intergenic
1036955939 8:13188466-13188488 TTAGATTAGCAGTTACTTTTGGG + Intronic
1037326788 8:17699867-17699889 CTGGATAAGCAATTACTTTCAGG + Intronic
1038115575 8:24551202-24551224 TTTGATAATCAGTTAAGTTTAGG - Intergenic
1038607456 8:29022737-29022759 ATTGATAACCATTTATTTTATGG - Intronic
1038829376 8:31040266-31040288 TTTGATAGCCAATTATTTACTGG - Intronic
1041385979 8:57303210-57303232 TTTAATATGAAGTTTTTTTCTGG + Intergenic
1041454447 8:58042762-58042784 TTTGATAAGCAGTTTTGATGTGG - Intronic
1042367128 8:67950450-67950472 TTGCATAAGCAGTTCTTTACTGG + Intergenic
1044406284 8:91830415-91830437 TTTGATATGCAGTTCTTTTGAGG + Intergenic
1044891616 8:96842136-96842158 TTTGAAAACCAGTTATTCTCAGG + Intronic
1045250384 8:100478656-100478678 TTTAAAAAGTAGTTAATTTCAGG - Intergenic
1045333328 8:101176474-101176496 TTTGATAAAAAGGGATTTTCAGG + Intergenic
1046529588 8:115426316-115426338 TTTAATAAGCAGATTTATTCTGG + Intronic
1046906992 8:119584098-119584120 TTTGATAAAAAGGTAATTTCAGG + Intronic
1047131437 8:122024879-122024901 TTTGTTAAGCAGATTTATTCTGG + Intergenic
1047346796 8:124036888-124036910 TTTGCTGAACAGGTATTTTCTGG - Intronic
1051138532 9:13951753-13951775 TTTGATAAAAAGTTTTTTTAAGG + Intergenic
1053636605 9:40012417-40012439 TTGGATAAGCAGTTCTTAACCGG + Intergenic
1053769386 9:41452199-41452221 TTGGATAAGCAGTTCTTAACCGG - Intergenic
1054317467 9:63609491-63609513 TTGGATAAGCAGTTCTTAACCGG + Intergenic
1054548055 9:66363702-66363724 TTGGATAAGCAGTTCTTAACCGG - Intergenic
1059072866 9:111157552-111157574 TTTAATAAGCAATTGTTTTATGG - Intergenic
1059903717 9:118957929-118957951 TTTCATTTGCAGTTTTTTTCTGG - Intergenic
1060510688 9:124229793-124229815 TTTAATAAGCAGGTATTGGCCGG + Intergenic
1203619241 Un_KI270749v1:104824-104846 TTTGCTAAGCATTTATTTCAAGG + Intergenic
1186290771 X:8096022-8096044 TTTGATAAGAAATATTTTTCAGG - Intergenic
1187036129 X:15541960-15541982 TTTGAAAATCTGTTATTTCCAGG + Exonic
1187655436 X:21466480-21466502 TTTGTTAAGCTGTAATTTTATGG - Intronic
1188083553 X:25875491-25875513 TTTCATAAGCAGGTATGTCCTGG - Intergenic
1190631060 X:52386713-52386735 TTTCAGAAGCATTTACTTTCAGG - Intergenic
1192859447 X:75050687-75050709 CTTGAAAAGCAGTTATTGTAGGG - Intergenic
1193388879 X:80904019-80904041 TATGTTAAGCATTTTTTTTCAGG + Intergenic
1194527650 X:94997664-94997686 TCTGATCAACATTTATTTTCAGG + Intergenic
1194548708 X:95270501-95270523 ATTGATATGCAGTTTTTTTGGGG + Intergenic
1194555229 X:95350094-95350116 TTTGATAGTCAGTTTTTTTGGGG - Intergenic
1196105195 X:111887874-111887896 TATGATGATCATTTATTTTCTGG - Intronic
1196151755 X:112382030-112382052 TTTGAGTAGCCGTTAGTTTCTGG - Intergenic
1197584005 X:128321605-128321627 ATTTATATGCAATTATTTTCAGG + Intergenic
1198614420 X:138440129-138440151 TTTAATAATGAGTTATTTTTAGG - Intergenic
1198688124 X:139249433-139249455 TTTGATAATTAGTTTTTTTGTGG - Intergenic
1199137919 X:144275087-144275109 TTTTATAAGCAAATATTTTAGGG - Intergenic
1199546149 X:149009088-149009110 TTTGATAAGTAGTCATTATGTGG + Intergenic
1201017465 Y:9620802-9620824 TGTGAAATGCAGTTATTTTTTGG - Intergenic
1201898721 Y:19023582-19023604 GTTGCTATGCAGTTGTTTTCAGG - Intergenic
1202083009 Y:21104369-21104391 TTTGTGAAGCAGTCATCTTCAGG - Intergenic
1202160983 Y:21936664-21936686 TGTGAAATGCAGTTATTTTTTGG - Intergenic
1202230373 Y:22649709-22649731 TGTGAAATGCAGTTATTTTTTGG + Intergenic
1202312783 Y:23546456-23546478 TGTGAAATGCAGTTATTTTTTGG - Intergenic
1202558019 Y:26124138-26124160 TGTGAAATGCAGTTATTTTTTGG + Intergenic