ID: 1125191933

View in Genome Browser
Species Human (GRCh38)
Location 15:37003699-37003721
Sequence CAACCCCCAAATATGAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125191933_1125191942 15 Left 1125191933 15:37003699-37003721 CCCAAATTCATATTTGGGGGTTG 0: 1
1: 0
2: 0
3: 6
4: 217
Right 1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG 0: 3
1: 4
2: 78
3: 516
4: 1822
1125191933_1125191943 16 Left 1125191933 15:37003699-37003721 CCCAAATTCATATTTGGGGGTTG 0: 1
1: 0
2: 0
3: 6
4: 217
Right 1125191943 15:37003738-37003760 TGTGAGGATATTAGGAAGTGGGG 0: 3
1: 7
2: 81
3: 492
4: 1699
1125191933_1125191936 8 Left 1125191933 15:37003699-37003721 CCCAAATTCATATTTGGGGGTTG 0: 1
1: 0
2: 0
3: 6
4: 217
Right 1125191936 15:37003730-37003752 ACCCCCAATGTGAGGATATTAGG 0: 1
1: 29
2: 237
3: 1094
4: 2432
1125191933_1125191941 14 Left 1125191933 15:37003699-37003721 CCCAAATTCATATTTGGGGGTTG 0: 1
1: 0
2: 0
3: 6
4: 217
Right 1125191941 15:37003736-37003758 AATGTGAGGATATTAGGAAGTGG 0: 4
1: 4
2: 77
3: 483
4: 1756
1125191933_1125191944 28 Left 1125191933 15:37003699-37003721 CCCAAATTCATATTTGGGGGTTG 0: 1
1: 0
2: 0
3: 6
4: 217
Right 1125191944 15:37003750-37003772 AGGAAGTGGGGCCTTCCAGTAGG 0: 1
1: 1
2: 1
3: 19
4: 274
1125191933_1125191935 0 Left 1125191933 15:37003699-37003721 CCCAAATTCATATTTGGGGGTTG 0: 1
1: 0
2: 0
3: 6
4: 217
Right 1125191935 15:37003722-37003744 AAATTCTAACCCCCAATGTGAGG 0: 1
1: 5
2: 26
3: 58
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125191933 Original CRISPR CAACCCCCAAATATGAATTT GGG (reversed) Intronic
900635010 1:3658855-3658877 CCACCCCTAAATATGACTGTAGG - Intronic
900635016 1:3658891-3658913 CCACCCCAAAATATGACTGTAGG - Intronic
900635022 1:3658927-3658949 CCACCCCAAAATATGACTGTAGG - Intronic
900635033 1:3658999-3659021 CCACCCCTAAATATGACTATAGG - Intronic
900698040 1:4024450-4024472 TGGCTCCCAAATATGAATTTTGG - Intergenic
900867957 1:5282201-5282223 GGACTCCCACATATGAATTTAGG - Intergenic
906052054 1:42882801-42882823 CAACCGCCAAATATAAAAGTTGG + Intergenic
907346845 1:53789137-53789159 TAATGCCCAAATATGCATTTGGG + Exonic
908466369 1:64399960-64399982 CAACTTCAATATATGAATTTGGG + Intergenic
913480519 1:119284476-119284498 CAACCACCAAGTAAAAATTTAGG + Intergenic
915542396 1:156576119-156576141 CCACCCCAAAATATGACTGTAGG + Intergenic
916043224 1:160979139-160979161 CCACCCCAAAATATGACTGTAGG + Intergenic
916960828 1:169887148-169887170 AAAACCTCATATATGAATTTGGG - Intronic
917250559 1:173055487-173055509 TTCCCCCCAAATCTGAATTTTGG + Intergenic
918157018 1:181857927-181857949 CAACCCCCAAATTTAAATTGTGG - Intergenic
921171450 1:212553411-212553433 CCACCCCAAAATATGTATATTGG - Intergenic
921495327 1:215832967-215832989 CACCCCCCAAATAAGTAATTAGG + Intronic
922873018 1:228918273-228918295 CAAGCTGCAATTATGAATTTTGG + Intergenic
923108283 1:230870681-230870703 CAAACTCCAAATATGTAATTAGG + Intergenic
1063902007 10:10743511-10743533 GAATCCTCAAATATGAGTTTGGG - Intergenic
1064000430 10:11659356-11659378 CAGCTCCAAAATATGAATATAGG - Intergenic
1064607846 10:17062655-17062677 CAGCCCCAAAATATGTGTTTGGG - Intronic
1066359647 10:34717849-34717871 CAACACTTAAATATTAATTTCGG + Intronic
1066534737 10:36379476-36379498 GAACCACCAAACATGAATATAGG - Intergenic
1066587059 10:36947211-36947233 CCACCTCCTAATATGATTTTGGG - Intergenic
1071306590 10:84304518-84304540 CTACCCCAAAATATGACTGTAGG - Intergenic
1072215653 10:93285382-93285404 CCACCCCAAAATATGACTGTAGG - Intergenic
1073660175 10:105466901-105466923 CCTCCCCCAATTATGTATTTAGG + Intergenic
1074425017 10:113343083-113343105 TAACCCCAAAGTATGTATTTGGG - Intergenic
1076590484 10:131578970-131578992 CAACTCCAAAATATGAACTGTGG + Intergenic
1079736633 11:24005302-24005324 CAAACCCCTAAAATGCATTTAGG - Intergenic
1080533293 11:33197655-33197677 CCACCCCCAATTTTCAATTTTGG + Intergenic
1081686490 11:45046842-45046864 CCACTCCCAACTATGACTTTGGG + Intergenic
1083446279 11:62709771-62709793 CAACCCCGAAATCTGGATTTCGG + Intronic
1085901203 11:80701909-80701931 CAACCTCCTAATATCATTTTGGG + Intergenic
1087394441 11:97579520-97579542 CTACCCCAAAATATGACTGTAGG + Intergenic
1087958368 11:104317982-104318004 CATCCTCCAAATATTATTTTTGG + Intergenic
1088589267 11:111388764-111388786 CATCCCCGATATATGAATTCTGG - Intronic
1089735575 11:120548283-120548305 CCACCCCCAAATCAGAATTCAGG - Intronic
1094028636 12:25985713-25985735 TCTCCCCCAAATATTAATTTTGG - Intronic
1094035065 12:26060934-26060956 CACACCCCAAAGATGAATATTGG - Intronic
1094565343 12:31593335-31593357 CAACACTCAAATATAAATTGAGG - Intergenic
1096617512 12:52842299-52842321 TAAACCCAAAATATCAATTTGGG - Intronic
1104371506 12:128227878-128227900 CCACCCCAAAATATGACTGTAGG - Intergenic
1106487355 13:30184182-30184204 CAACCATCAAATATGATTTAAGG + Intergenic
1106664613 13:31838405-31838427 AAACTCTCAAAAATGAATTTTGG - Intergenic
1106905631 13:34406438-34406460 CAATCCCCAAATATACAGTTGGG - Intergenic
1107396008 13:40018272-40018294 GAACCTCAACATATGAATTTTGG + Intergenic
1107465583 13:40646939-40646961 CTACCCCAAAATATGACTGTAGG + Intronic
1108497790 13:51042348-51042370 CCATTTCCAAATATGAATTTGGG + Intergenic
1109032936 13:57217055-57217077 CGACCTCAACATATGAATTTTGG - Intergenic
1110603327 13:77401717-77401739 AAATCCCAATATATGAATTTTGG + Intergenic
1111563093 13:89978286-89978308 CAACTTCAACATATGAATTTGGG - Intergenic
1112057251 13:95701222-95701244 CTACCCCAAAATATGACTTCAGG + Intronic
1114844496 14:26304780-26304802 AAAACACAAAATATGAATTTGGG + Intergenic
1117198048 14:53360967-53360989 CAAACCCCAAATATGATCCTGGG + Intergenic
1119192464 14:72692411-72692433 CAACTTCCAATTATGAATTAGGG - Intronic
1119653650 14:76401087-76401109 CAACCCTCCCATATGAATATTGG - Intronic
1120425520 14:84342250-84342272 ACATCCCCAAATATTAATTTGGG - Intergenic
1125191933 15:37003699-37003721 CAACCCCCAAATATGAATTTGGG - Intronic
1125332955 15:38600153-38600175 CCACCCCAAAATATGACTGTAGG - Intergenic
1126617565 15:50600920-50600942 GAACACCCAATTAAGAATTTTGG - Intronic
1126990314 15:54367404-54367426 AAACTCCCAAATAGGAATTAAGG - Intronic
1128417057 15:67456726-67456748 GAACTCCCAAATATGGATTTTGG + Intronic
1129077889 15:73013118-73013140 TAGCACCCAAATATGAATATTGG + Intergenic
1130410499 15:83644076-83644098 CTGGCCCCATATATGAATTTGGG + Intergenic
1132388431 15:101419818-101419840 CAATCACCAAATATTGATTTGGG + Intronic
1133511237 16:6459414-6459436 CATCCCCTCAGTATGAATTTAGG + Intronic
1135209228 16:20509946-20509968 GGACCTCAAAATATGAATTTGGG + Intergenic
1136346577 16:29679685-29679707 CAACCCCCAACCATGAAGTCCGG + Intronic
1140828795 16:78732153-78732175 CAACCCCAAAACTTGAATCTGGG + Intronic
1141223028 16:82089527-82089549 CAGCCCCAGAATATGAATTGAGG - Intronic
1141412090 16:83842272-83842294 CCACCCCAAAATATGAATCAAGG + Intergenic
1143990293 17:10953460-10953482 GAACTTCAAAATATGAATTTTGG + Intergenic
1145817819 17:27808138-27808160 CAATGCCCACAGATGAATTTAGG - Intronic
1145894860 17:28449799-28449821 TAACCCCTAAATATGATATTAGG - Intergenic
1150555446 17:66249979-66250001 CCACCCCCAAATATGACTGCAGG + Intronic
1152360065 17:79828703-79828725 CAACACCCATATATGCATATGGG - Intergenic
1153365478 18:4250856-4250878 AAACCCTAAAGTATGAATTTAGG + Intronic
1157040070 18:44028174-44028196 AAACCACTAAATAAGAATTTAGG - Intergenic
1158244881 18:55420843-55420865 TTTCCCCCAAATCTGAATTTGGG - Intronic
1162582855 19:11540920-11540942 CATCCCCCAACTATGGATCTGGG + Intronic
1163570325 19:18077747-18077769 GAATCCCTAAATATGAATTAGGG + Intronic
1163833676 19:19560385-19560407 CAGCACCCAAACATGAATTGGGG + Intergenic
1163892855 19:20032178-20032200 AAACCCCCAAATTTGAATCCAGG - Intronic
1164675907 19:30101305-30101327 CAACTCCCAAATATGTTTCTAGG + Intergenic
1165014793 19:32872848-32872870 CACCCCCAAAATATGACTGTAGG - Intergenic
925623757 2:5821147-5821169 CAACTCCCCACTCTGAATTTTGG - Intergenic
926300423 2:11598027-11598049 CAACACCCACACATGGATTTCGG - Intronic
929085958 2:38167643-38167665 TAACCCCCAAATTTGCCTTTGGG + Intergenic
930896862 2:56456572-56456594 TAATCCCCAAATGTGAAGTTAGG - Intergenic
933844399 2:86313893-86313915 GAAGCCCAAAATTTGAATTTTGG + Intronic
935219621 2:101001500-101001522 CAACCCTCAAATTTAAATTCTGG - Intergenic
935691018 2:105732643-105732665 CAACCCTGAAATAAGGATTTGGG + Intergenic
935811098 2:106797819-106797841 CAACTCCCAAATATAAGATTTGG - Intergenic
937104353 2:119296016-119296038 CCATCCCCAAATGTGCATTTTGG - Intergenic
942721106 2:178953466-178953488 CAACCCCCAAATTCCACTTTTGG + Intronic
942755196 2:179332547-179332569 CCAGACACAAATATGAATTTTGG - Intergenic
946192080 2:218012848-218012870 CCACTCCCATATGTGAATTTTGG - Intergenic
946782695 2:223207168-223207190 AAACAACCTAATATGAATTTGGG + Intergenic
947368861 2:229424717-229424739 CAACTTCAACATATGAATTTGGG + Intronic
947702586 2:232247015-232247037 CAAACACTAAATATGAAGTTAGG + Intronic
947783160 2:232788884-232788906 GATCCCCCAAATATAAAGTTTGG + Intronic
1168821703 20:777792-777814 CACCCCCAAAATATGACTCTGGG + Intergenic
1169465011 20:5829649-5829671 AAACCCCCAAACTTAAATTTAGG - Intronic
1170936830 20:20817786-20817808 CCACCCCAAAATATGACTATAGG + Intergenic
1171984384 20:31649454-31649476 GAACATCCACATATGAATTTGGG + Intergenic
1172065362 20:32216092-32216114 AAACCCCCAAGTATGTCTTTCGG + Intronic
1172300634 20:33847396-33847418 CCACCCCAAAATATGACTGTAGG - Intronic
1176968318 21:15236757-15236779 CAACAATCAAATATGCATTTAGG + Intergenic
1177234044 21:18362447-18362469 CTACCTCCAAATATCTATTTTGG - Intronic
1178291845 21:31374917-31374939 CAACCACTAAAAATGAAGTTTGG + Intronic
1179390268 21:40982621-40982643 CAAACCCAAAATATAAATTATGG - Intergenic
1180240770 21:46503448-46503470 CAACCCCCAAAAAAGTATGTTGG - Intronic
1184681835 22:46076464-46076486 CAAGCCCCAAACATGTAGTTGGG + Intronic
949489242 3:4571948-4571970 CAAGCACCTACTATGAATTTAGG + Intronic
951631405 3:24725240-24725262 CAACCCGCAACAAAGAATTTGGG + Intergenic
953616376 3:44494135-44494157 CCACCCCCAAATATAACATTTGG - Intergenic
953689217 3:45103545-45103567 CCACACCTCAATATGAATTTGGG - Intronic
954065072 3:48099275-48099297 CCACCCCAAAATATGACTATAGG + Intergenic
956505947 3:69940233-69940255 CAACCCAAACCTATGAATTTTGG + Intronic
957546338 3:81643225-81643247 CATCCTCAAAATGTGAATTTTGG - Intronic
959156970 3:102678850-102678872 CAACCCCAAAATATGCCTCTTGG - Intergenic
959465871 3:106686428-106686450 AAGCCACAAAATATGAATTTGGG + Intergenic
959490658 3:106984778-106984800 CAACCACCTAATTTGAATCTTGG + Intergenic
960028738 3:113036688-113036710 CAACCCACAGAACTGAATTTTGG - Intergenic
960240658 3:115338190-115338212 AAACCTCAACATATGAATTTGGG - Intergenic
963851114 3:150211335-150211357 CAATCCCCAAAGATAAATCTAGG + Intergenic
963948627 3:151173496-151173518 CAATTTCCAAATATGAATATTGG + Intronic
964268812 3:154932561-154932583 TAACTCCCATATATGAATTAGGG - Intergenic
967459395 3:189727799-189727821 CTGCCCCCAAATTAGAATTTAGG - Intronic
970040420 4:11790949-11790971 GCACCCCCAAAGCTGAATTTAGG + Intergenic
970487261 4:16536994-16537016 CAATACCGAAATATGAGTTTAGG - Intronic
970841836 4:20481501-20481523 AAACCTACAAATGTGAATTTTGG - Intronic
971574420 4:28255122-28255144 GAACTCCCAAATTTGAATGTTGG - Intergenic
972391414 4:38617177-38617199 CAATACTCAAATATGAAGTTTGG - Intergenic
973778295 4:54264030-54264052 AAATCCCCAAATCAGAATTTAGG - Intronic
975052753 4:69885837-69885859 AACACCCAAAATATGAATTTGGG - Intergenic
975194704 4:71510074-71510096 AAACTCCCTAATCTGAATTTTGG + Intronic
976574020 4:86647964-86647986 CAGCCCCCAAAAATGAATACAGG + Intronic
977360582 4:95999318-95999340 CAGCCTCAACATATGAATTTTGG + Intergenic
977818969 4:101449759-101449781 CAAATCCCAAATAAGAAATTGGG - Intronic
979180922 4:117726222-117726244 CGGCCCCAAAACATGAATTTTGG + Intergenic
979385027 4:120054567-120054589 CAGCCCCCAAACCTCAATTTAGG - Intergenic
979478731 4:121189160-121189182 CAAAGCCAAAATAAGAATTTAGG + Intronic
980498584 4:133617749-133617771 CAACCACCAAATAGTAACTTAGG + Intergenic
982378178 4:154717937-154717959 CCACCCCAAAATATGACTGTAGG + Intronic
982816865 4:159896900-159896922 CACCCCCCAAATTTGTATGTTGG + Intergenic
983067954 4:163234477-163234499 GAACCCCCAAATCTACATTTCGG + Intergenic
985120165 4:186631899-186631921 GAACCTGGAAATATGAATTTGGG - Intronic
987596156 5:20001988-20002010 CAACCCTGATATATGAATATTGG - Intronic
987800476 5:22689937-22689959 TTAACCCCAAATTTGAATTTTGG + Intronic
988325511 5:29761586-29761608 CATCTCCTAAATATGAAATTAGG - Intergenic
989174831 5:38513700-38513722 CAAACGCCAAATATTATTTTAGG - Intronic
992238229 5:74734961-74734983 CAAGCCCACAATTTGAATTTAGG + Intronic
993303931 5:86251342-86251364 TAACCCCCAAACATAATTTTTGG + Intergenic
995455113 5:112343057-112343079 CAAAGCACAAATAAGAATTTGGG + Intronic
995511029 5:112909550-112909572 CTACCTGCAAACATGAATTTGGG - Intronic
998579389 5:143355290-143355312 CAACCCCAAAATTCTAATTTAGG + Intronic
999053779 5:148551879-148551901 CAAACCCCACATTTGAATATGGG + Intronic
999479775 5:151937103-151937125 CAACCCCCCAAAATTAATTAAGG - Intergenic
999502816 5:152163836-152163858 TTACCCCCAAGTATGGATTTGGG + Intergenic
1004960174 6:20779487-20779509 TCACCCCAAAATAAGAATTTGGG - Intronic
1008225497 6:48910031-48910053 CAACTTCAACATATGAATTTTGG - Intergenic
1010565990 6:77414640-77414662 CAACCCTCATGGATGAATTTCGG - Intergenic
1011562456 6:88634659-88634681 GAACCTCCGAATTTGAATTTTGG - Intronic
1011870189 6:91883163-91883185 CAACCCCCAAACTTGACTTTTGG - Intergenic
1012293902 6:97495483-97495505 CCACCCCCAATTTTGAATTGAGG + Intergenic
1012603910 6:101133219-101133241 AAATCCCAACATATGAATTTTGG - Intergenic
1012967430 6:105689760-105689782 CAAACTCTAAAGATGAATTTTGG + Intergenic
1013380273 6:109561966-109561988 TAATCCCCAAATCTGAAATTTGG + Intronic
1014553841 6:122821579-122821601 CCACTCCCAAATGTGAAATTTGG + Intergenic
1015696675 6:135988193-135988215 CAACCCACAAATATTATTTGTGG + Intronic
1016106873 6:140173848-140173870 CAACTACCAAATGTGCATTTTGG - Intergenic
1017705761 6:157121333-157121355 CTACCCCCAAATATGCTTTAAGG + Intronic
1020831965 7:13103732-13103754 AGACCCCAATATATGAATTTGGG - Intergenic
1021185208 7:17556066-17556088 CAGTGCTCAAATATGAATTTGGG + Intergenic
1021532959 7:21670101-21670123 CAGCCTCTAAATATAAATTTTGG + Intronic
1023268621 7:38435469-38435491 GGAGCCCCACATATGAATTTAGG - Intronic
1025783155 7:64619705-64619727 CCACCCCAAAAAATGGATTTTGG - Intergenic
1026764297 7:73150140-73150162 TAACACCCCAACATGAATTTCGG + Intergenic
1027040766 7:74959911-74959933 TAACACCCCAACATGAATTTCGG + Intergenic
1027082871 7:75242446-75242468 TAACACCCCAACATGAATTTCGG - Intergenic
1028302097 7:89212885-89212907 CCACCCCAAAATATGACTGTAGG - Intronic
1028898992 7:96075304-96075326 CAACACCCAAAAGTCAATTTTGG + Intronic
1028898997 7:96075310-96075332 AAACCCCCAAAATTGACTTTTGG - Intronic
1029105915 7:98175603-98175625 CACCCACCATATATGAATTCCGG - Intronic
1031938842 7:127765942-127765964 CAGCCATCAAAAATGAATTTTGG - Intronic
1031960091 7:127981371-127981393 CAATCCCCAAAAATGAACATGGG + Intronic
1033299599 7:140175538-140175560 CAACACCCAAATAAGGACTTTGG + Intronic
1036097775 8:5742374-5742396 CCAAATCCAAATATGAATTTTGG + Intergenic
1037403619 8:18518554-18518576 CCACCCCAAAATATGACTCTAGG - Intergenic
1037692897 8:21197701-21197723 GAACCTCAATATATGAATTTTGG - Intergenic
1040973598 8:53164816-53164838 CAAGCCTCAAACATGAGTTTTGG - Intergenic
1041343431 8:56870425-56870447 CAACTTCAACATATGAATTTGGG - Intergenic
1043972293 8:86544987-86545009 CATGCCCCAAGTATGAATTGTGG - Intronic
1046051320 8:109025918-109025940 GAATCCCTAAATATGACTTTTGG - Intergenic
1047218688 8:122900680-122900702 CAACTCCCATTTATGAACTTTGG - Intronic
1047963248 8:130026169-130026191 CCACCCCAAAATATGACTGTAGG + Intergenic
1050149763 9:2607824-2607846 CAGCCCCCAGATAAGATTTTAGG - Intergenic
1050685226 9:8161102-8161124 AAAGCCCCAGACATGAATTTTGG + Intergenic
1050846741 9:10230642-10230664 CAACCACAAAATTTTAATTTGGG - Intronic
1051169854 9:14310143-14310165 CAACCTTCAAATTTGAATTTTGG - Intronic
1052122612 9:24737579-24737601 AAATCACCAAATAAGAATTTTGG - Intergenic
1052134719 9:24895848-24895870 GAACTCCAAAATATAAATTTGGG + Intergenic
1054861534 9:69958644-69958666 CAACCCCAAAATATGATGGTAGG - Intergenic
1055051294 9:71984042-71984064 CAAAGCCAAAATGTGAATTTTGG + Intronic
1055421634 9:76149507-76149529 TAATCCACAAATAGGAATTTTGG + Intronic
1055856335 9:80692285-80692307 CAATCCCCAAAGATGGATGTGGG + Intergenic
1056085794 9:83148286-83148308 GAACTTCAAAATATGAATTTGGG - Intergenic
1056126884 9:83543470-83543492 CAACCCCCAAATTTGAGCTATGG + Intergenic
1056757691 9:89392175-89392197 AACCCCCCAAAAATGGATTTGGG - Intronic
1056826133 9:89877527-89877549 CAACGCCAACATATGAATTTGGG - Intergenic
1059133932 9:111784921-111784943 CCACCTTCAAATATAAATTTGGG + Intronic
1061109415 9:128557590-128557612 CATTCCCCAAATAAAAATTTGGG - Intronic
1186299491 X:8184263-8184285 GTACACCCAAATATGAATTCAGG - Intergenic
1186682674 X:11892227-11892249 CAAAGCCAAAATAAGAATTTAGG - Intergenic
1186746847 X:12578159-12578181 CTAACCCCAAATATGATATTTGG - Intronic
1188736204 X:33719457-33719479 CATCACCCAAATTGGAATTTTGG - Intergenic
1188847310 X:35088785-35088807 ACACCCCCAAATAGGAACTTGGG - Intergenic
1189679294 X:43498553-43498575 GAACCTCAACATATGAATTTTGG + Intergenic
1190569875 X:51770160-51770182 GAACCTCCAAACAAGAATTTGGG - Intergenic
1196628481 X:117907022-117907044 TAAAGCCTAAATATGAATTTAGG + Intronic
1201281975 Y:12350221-12350243 CCTCCCCCAAATATGACTTCTGG + Intergenic