ID: 1125191934

View in Genome Browser
Species Human (GRCh38)
Location 15:37003700-37003722
Sequence TCAACCCCCAAATATGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125191934_1125191942 14 Left 1125191934 15:37003700-37003722 CCAAATTCATATTTGGGGGTTGA 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG 0: 3
1: 4
2: 78
3: 516
4: 1822
1125191934_1125191935 -1 Left 1125191934 15:37003700-37003722 CCAAATTCATATTTGGGGGTTGA 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1125191935 15:37003722-37003744 AAATTCTAACCCCCAATGTGAGG 0: 1
1: 5
2: 26
3: 58
4: 357
1125191934_1125191936 7 Left 1125191934 15:37003700-37003722 CCAAATTCATATTTGGGGGTTGA 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1125191936 15:37003730-37003752 ACCCCCAATGTGAGGATATTAGG 0: 1
1: 29
2: 237
3: 1094
4: 2432
1125191934_1125191943 15 Left 1125191934 15:37003700-37003722 CCAAATTCATATTTGGGGGTTGA 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1125191943 15:37003738-37003760 TGTGAGGATATTAGGAAGTGGGG 0: 3
1: 7
2: 81
3: 492
4: 1699
1125191934_1125191941 13 Left 1125191934 15:37003700-37003722 CCAAATTCATATTTGGGGGTTGA 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1125191941 15:37003736-37003758 AATGTGAGGATATTAGGAAGTGG 0: 4
1: 4
2: 77
3: 483
4: 1756
1125191934_1125191944 27 Left 1125191934 15:37003700-37003722 CCAAATTCATATTTGGGGGTTGA 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1125191944 15:37003750-37003772 AGGAAGTGGGGCCTTCCAGTAGG 0: 1
1: 1
2: 1
3: 19
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125191934 Original CRISPR TCAACCCCCAAATATGAATT TGG (reversed) Intronic
900833441 1:4981358-4981380 TCATCCACCAAATATGAACATGG + Intergenic
902274739 1:15331313-15331335 CCAACCCACAGATATGTATTAGG - Intronic
902973696 1:20073578-20073600 TCAGCCACCAGATATGCATTAGG + Intronic
910967275 1:92820129-92820151 TCAGCCACCAAATATTCATTTGG - Intergenic
912218514 1:107644730-107644752 TCACCACCCAAATATATATTAGG + Intronic
914260579 1:145995986-145996008 TCACCCTCCAACAATGAATTGGG + Intronic
915319416 1:155048000-155048022 GCATCCCCCAAATATGGAGTTGG - Intronic
915756470 1:158265772-158265794 TATACACCCATATATGAATTTGG + Intergenic
917625000 1:176836729-176836751 TCACCCCCAAAATCTGGATTAGG + Intronic
918227980 1:182503936-182503958 TCAGCCCCCAAATTTTTATTTGG + Intronic
919589975 1:199489653-199489675 ACAAACCCCAAATATGAGTTGGG + Intergenic
922093625 1:222422125-222422147 TGAACCCTCAAAGATGAATGAGG - Intergenic
924503124 1:244654793-244654815 ACATCCCCCTAATCTGAATTTGG + Intronic
1063103695 10:2973945-2973967 TCAACCCTCAAATATAAAACAGG - Intergenic
1063255965 10:4327676-4327698 TCAACCACCAAATTTGTATGAGG - Intergenic
1063860591 10:10303482-10303504 TGACCCCCCCAATATAAATTGGG - Intergenic
1064607847 10:17062656-17062678 TCAGCCCCAAAATATGTGTTTGG - Intronic
1072224628 10:93357107-93357129 CCCACCCCCAAATCTGAATGAGG - Intronic
1074425018 10:113343084-113343106 TTAACCCCAAAGTATGTATTTGG - Intergenic
1078613240 11:12840472-12840494 TCAACCCCAGTACATGAATTTGG - Intronic
1086402072 11:86469242-86469264 TCCAGCCCCAAATATTAAGTAGG - Intronic
1087159949 11:94939013-94939035 TCATCCCCCAAACATGTATGAGG - Intergenic
1087434957 11:98103222-98103244 AAAACCACCAAATAGGAATTTGG - Intergenic
1091175137 11:133550962-133550984 TCTACCAGAAAATATGAATTGGG + Intergenic
1095821159 12:46479907-46479929 TCATCCAGCAAATATTAATTGGG - Intergenic
1097289891 12:57905767-57905789 TCCACCCAAAATTATGAATTGGG - Intergenic
1100106078 12:91173737-91173759 TCAACCCAGAAAAATAAATTAGG - Intronic
1100167841 12:91938497-91938519 TCCACCACCAAGTATGAAATGGG + Intergenic
1101451803 12:104786664-104786686 TTAAGCCCCAATTATGAATGTGG - Intergenic
1110127216 13:71960590-71960612 TAAAGCCCTAAAAATGAATTAGG - Intergenic
1116516385 14:45811536-45811558 TAACCCAGCAAATATGAATTTGG + Intergenic
1117316011 14:54570998-54571020 TCGAGTCCCATATATGAATTTGG - Intronic
1119192465 14:72692412-72692434 TCAACTTCCAATTATGAATTAGG - Intronic
1119605430 14:76012182-76012204 CTAACCCCAAAATATGAATCAGG - Intronic
1125191934 15:37003700-37003722 TCAACCCCCAAATATGAATTTGG - Intronic
1125393823 15:39225650-39225672 GCAACCCCAAAATATTATTTTGG - Intergenic
1125842086 15:42812401-42812423 TTAACCCCCAAATCTAAATGAGG - Intronic
1126442475 15:48704802-48704824 TCAACTCCAAACTATGATTTGGG - Intergenic
1128100644 15:64996618-64996640 TAAATCCCCAAATATGCAGTTGG + Intergenic
1137404163 16:48176815-48176837 TCATCCCCCAAATATGTATTAGG - Intronic
1142009579 16:87706990-87707012 TCAACTCCCAGATAAGAAATGGG + Intronic
1143070556 17:4288681-4288703 TCCACCCCCAATTCTAAATTTGG + Intronic
1143853000 17:9826801-9826823 TAAGCCCCCAAATGTGAATGAGG - Intronic
1148575311 17:48706411-48706433 TCAACTCCCGAAGATAAATTGGG + Intergenic
1148756857 17:49977714-49977736 TCCACCCCCAAATCTGAGGTGGG + Intergenic
1149264763 17:54915513-54915535 TAAACCCCAAAATATGCTTTAGG - Intronic
1149527106 17:57365356-57365378 TCTACCAACAAATATGCATTAGG + Intronic
1153910058 18:9698780-9698802 TGCTCTCCCAAATATGAATTAGG - Intergenic
1157394808 18:47332622-47332644 TCAACCAACAAATATTTATTGGG - Intergenic
1157457544 18:47848162-47848184 TTAACCCCCAAATCTGAACATGG + Intronic
1158040155 18:53083730-53083752 ACAACCCCCAAATTTTAATCAGG - Intronic
1158244882 18:55420844-55420866 TTTTCCCCCAAATCTGAATTTGG - Intronic
1161219522 19:3111959-3111981 TCTAAGCCCAAATATGAATATGG - Intronic
1163570324 19:18077746-18077768 TGAATCCCTAAATATGAATTAGG + Intronic
1163833675 19:19560384-19560406 CCAGCACCCAAACATGAATTGGG + Intergenic
1166734074 19:45074455-45074477 TGAGCCCCCAAACCTGAATTTGG + Intronic
925238498 2:2299853-2299875 TCAATCCCCAAATCTTACTTTGG + Intronic
925695624 2:6574982-6575004 TCAACCCGGAAATATGGATTGGG + Intergenic
926397717 2:12461464-12461486 TCAACTCCCAAATCTATATTTGG - Intergenic
927098888 2:19771604-19771626 TCAACCCACAACAATGAATAAGG + Intergenic
929029090 2:37634264-37634286 CCAACACCCTAATATGAATTAGG - Intergenic
929647791 2:43646961-43646983 TCAACACAAAAATATGAATAAGG + Intronic
933256044 2:80081884-80081906 TCAATCTTCAAATATGGATTTGG - Intronic
934592691 2:95570469-95570491 TCAACTCCCATTTATGAATGAGG - Intergenic
935378312 2:102422646-102422668 TCAACTCTCAAATATGAAAGGGG - Intronic
935384987 2:102490599-102490621 TAAACCCCAACATATAAATTTGG + Intronic
937619772 2:123972068-123972090 TGAGACCCCAAATATGAACTAGG - Intergenic
938223120 2:129588736-129588758 TTAACCATCAAATATGAATTTGG - Intergenic
939056351 2:137369525-137369547 TCAACCCCCAAATATAATCTTGG - Intronic
939408013 2:141784899-141784921 TCAAGTCCTACATATGAATTTGG + Intronic
940268480 2:151865618-151865640 TCACACCACAAATATTAATTGGG - Intronic
941764975 2:169286810-169286832 TCAACTCCCAAAGAGGAGTTGGG - Intronic
941999805 2:171634553-171634575 TCAATCCACAGATATTAATTAGG + Intergenic
942216221 2:173721383-173721405 TCAAACACCAAATTTGTATTGGG - Intergenic
943871960 2:193011468-193011490 TCAAGCCCCAGATCTGACTTGGG + Intergenic
944639843 2:201713639-201713661 TCAACCCCAAAATTTTGATTTGG + Intronic
945385415 2:209193583-209193605 TCTTTCCCCAAATATCAATTTGG + Intergenic
946606241 2:221408541-221408563 TCATCTCCCAATTATGATTTAGG - Intergenic
947449492 2:230194178-230194200 CCAGCTCCCAAACATGAATTAGG - Intronic
1169865078 20:10191313-10191335 TCCAACCCCAAATAGAAATTAGG + Intergenic
1172034060 20:31999568-31999590 TCAGCCTCCAAAGATGGATTTGG - Exonic
1175268070 20:57714579-57714601 TCATTCCACAAATATGCATTGGG + Intergenic
1178613080 21:34103825-34103847 GTAACCCCCAAATATAATTTTGG - Exonic
1179354571 21:40647044-40647066 TCAAGCCACAAATATGCATGGGG + Intronic
1182889202 22:33802672-33802694 TCAACCCACCAAGGTGAATTGGG + Intronic
955248621 3:57254241-57254263 TCAACCAACAAATATTTATTGGG + Intronic
955645493 3:61133128-61133150 TCAAACCCCAAGAATAAATTAGG + Intronic
955779412 3:62468209-62468231 TCAAGACCTAAAAATGAATTTGG - Intronic
956535571 3:70272183-70272205 TCAAACCCCCACTATGCATTTGG - Intergenic
956753609 3:72364487-72364509 TCAACATCAACATATGAATTTGG + Intergenic
958042080 3:88238732-88238754 TCAATTCCCAAATAAGAATTTGG - Intergenic
961728158 3:128946359-128946381 TCGACCCCCAGATATATATTTGG - Intronic
964268813 3:154932562-154932584 TTAACTCCCATATATGAATTAGG - Intergenic
966447193 3:180014808-180014830 CGAACCCCGAAATCTGAATTGGG + Intronic
966480763 3:180405790-180405812 TCAGCCCCCAACTATTAATGTGG - Intergenic
970320517 4:14871125-14871147 TCATCACACAAATATGAATAAGG - Intergenic
971296515 4:25398402-25398424 TCCACCCCCAAATATCAACAGGG - Intronic
974042287 4:56867903-56867925 ACTACCTCCAAATATAAATTTGG - Intergenic
974317128 4:60296879-60296901 TCTACACCCAAATATGATTTTGG + Intergenic
977285599 4:95102400-95102422 TCTACTACCAAATATGTATTGGG - Intronic
977818970 4:101449760-101449782 TCAAATCCCAAATAAGAAATTGG - Intronic
980652454 4:135736189-135736211 TCAACCTCTAAATTTTAATTAGG - Intergenic
981257348 4:142677765-142677787 TCAACCCCCATTTATGAGTGAGG - Intronic
981758442 4:148167370-148167392 TCAACCCCCAAATTTAAATGGGG + Intronic
981847540 4:149186650-149186672 TCACCTCCAAAACATGAATTTGG - Intergenic
983094724 4:163548340-163548362 TCAACCCTCAATTATAAAATTGG + Intronic
983395654 4:167192290-167192312 CCAACCCGATAATATGAATTTGG + Intronic
983569068 4:169185146-169185168 TCATCCCACAAATATTTATTAGG + Intronic
986525308 5:8667554-8667576 TGACCTGCCAAATATGAATTGGG + Intergenic
986800600 5:11256244-11256266 TCAACACACAAATATGACCTAGG - Intronic
987037587 5:14033507-14033529 TCATCCATCAAATATGTATTGGG - Intergenic
988367536 5:30320088-30320110 TCAGCCATCAAATATGAATAAGG + Intergenic
989273115 5:39555319-39555341 GCAAGCCCCAAATCTGAAATAGG - Intergenic
990606955 5:57420344-57420366 TCAAAAACCAAATATCAATTTGG - Intergenic
995563337 5:113407002-113407024 GCAGCCCCTAAATATAAATTTGG + Intronic
996404515 5:123092518-123092540 TCAATACCCATATATTAATTAGG - Intronic
998312220 5:141144996-141145018 TCAACCACCAAACATAATTTAGG - Intronic
998407702 5:141883277-141883299 TCAGCCCCCAGAGATGAATGGGG - Intergenic
998561272 5:143173901-143173923 TCTGCCCACAAAGATGAATTTGG + Intronic
999805939 5:155081423-155081445 TTAAACACCAAATATTAATTGGG + Intergenic
1000140460 5:158398323-158398345 TCAACCATCAAATGTGAAATGGG - Intergenic
1005141711 6:22639383-22639405 TTAACTCCCAACTATAAATTGGG - Intergenic
1005196631 6:23294582-23294604 GCAACCCCTAAATGTGCATTTGG - Intergenic
1017786761 6:157763022-157763044 GCAACCCCCAAATATGCATAAGG - Intronic
1021185207 7:17556065-17556087 TCAGTGCTCAAATATGAATTTGG + Intergenic
1021853023 7:24827091-24827113 TCCACCCAAAAATATTAATTCGG + Intronic
1028111120 7:86942626-86942648 TTTACCCCCAAATAAAAATTTGG - Intronic
1028414712 7:90567442-90567464 TTAAACCACAAATATCAATTAGG - Intronic
1032719573 7:134539562-134539584 TCTTCCCCCAAATATGCATATGG - Intronic
1033590240 7:142802685-142802707 CCAACCCCCAAGTACGAAATAGG + Intergenic
1036481453 8:9143269-9143291 TCATCCCACAAATAGGGATTGGG + Intronic
1041189466 8:55338767-55338789 TCAACCCCTAAAGCTTAATTTGG - Intronic
1041343136 8:56866846-56866868 TCTTCCCCCAAATTTGAATGAGG + Intergenic
1047341184 8:123981826-123981848 TTAACCCCCAAATATGCCTATGG - Intronic
1047530586 8:125670679-125670701 TCAACCTCCAAATACAAAATAGG + Intergenic
1048711593 8:137217901-137217923 TCAAACCCCAAATAAAATTTGGG - Intergenic
1050579012 9:7031060-7031082 TCAAAACCCAAACATGAAATGGG + Intronic
1051456295 9:17262615-17262637 TTAACCCCGAAATATGCATTAGG - Intronic
1052134718 9:24895847-24895869 TGAACTCCAAAATATAAATTTGG + Intergenic
1053536703 9:38933548-38933570 TCAACTCCCACTTATGAATGAGG + Intergenic
1054629430 9:67430382-67430404 TCAACTCCCACTTATGAATGAGG - Intergenic
1056757692 9:89392176-89392198 TAACCCCCCAAAAATGGATTTGG - Intronic
1056826134 9:89877528-89877550 TCAACGCCAACATATGAATTTGG - Intergenic
1057863100 9:98657695-98657717 TCATCCCCCAAATCTGCATATGG + Intronic
1058959735 9:109981284-109981306 TCAACCAACAAATATTTATTAGG + Intronic
1059286695 9:113178935-113178957 TCCACCCCATAATTTGAATTTGG - Intronic
1061109416 9:128557591-128557613 TCATTCCCCAAATAAAAATTTGG - Intronic
1188506975 X:30893358-30893380 TCATACTCCAAATATGAGTTTGG - Intronic
1190569876 X:51770161-51770183 TGAACCTCCAAACAAGAATTTGG - Intergenic
1194207091 X:91023345-91023367 TCAACACAAAAATATAAATTTGG - Intergenic
1194411783 X:93566369-93566391 CCACCCCCCAAAAAAGAATTTGG + Intergenic
1199702273 X:150390929-150390951 TCAACCCCAAATTATGTATCTGG - Intronic
1200552837 Y:4598113-4598135 TCAACACAAAAATATAAATTTGG - Intergenic
1200966565 Y:9044517-9044539 TTAGGCCCCAAATATGAAGTGGG - Intergenic