ID: 1125191942

View in Genome Browser
Species Human (GRCh38)
Location 15:37003737-37003759
Sequence ATGTGAGGATATTAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2423
Summary {0: 3, 1: 4, 2: 78, 3: 516, 4: 1822}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125191934_1125191942 14 Left 1125191934 15:37003700-37003722 CCAAATTCATATTTGGGGGTTGA 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG 0: 3
1: 4
2: 78
3: 516
4: 1822
1125191933_1125191942 15 Left 1125191933 15:37003699-37003721 CCCAAATTCATATTTGGGGGTTG 0: 1
1: 0
2: 0
3: 6
4: 217
Right 1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG 0: 3
1: 4
2: 78
3: 516
4: 1822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125191942 Original CRISPR ATGTGAGGATATTAGGAAGT GGG Intronic
Too many off-targets to display for this crispr