ID: 1125191965

View in Genome Browser
Species Human (GRCh38)
Location 15:37003875-37003897
Sequence GAGACGGCTGTCTCTACACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125191959_1125191965 3 Left 1125191959 15:37003849-37003871 CCCCTTCTGCCATATGAGGACAT 0: 3
1: 23
2: 161
3: 532
4: 1203
Right 1125191965 15:37003875-37003897 GAGACGGCTGTCTCTACACCGGG 0: 1
1: 0
2: 0
3: 4
4: 112
1125191954_1125191965 21 Left 1125191954 15:37003831-37003853 CCCTGGAGAGCTCCCTCACCCCT 0: 3
1: 15
2: 67
3: 166
4: 632
Right 1125191965 15:37003875-37003897 GAGACGGCTGTCTCTACACCGGG 0: 1
1: 0
2: 0
3: 4
4: 112
1125191961_1125191965 1 Left 1125191961 15:37003851-37003873 CCTTCTGCCATATGAGGACATAT 0: 1
1: 6
2: 77
3: 549
4: 1355
Right 1125191965 15:37003875-37003897 GAGACGGCTGTCTCTACACCGGG 0: 1
1: 0
2: 0
3: 4
4: 112
1125191960_1125191965 2 Left 1125191960 15:37003850-37003872 CCCTTCTGCCATATGAGGACATA 0: 3
1: 28
2: 288
3: 774
4: 1634
Right 1125191965 15:37003875-37003897 GAGACGGCTGTCTCTACACCGGG 0: 1
1: 0
2: 0
3: 4
4: 112
1125191956_1125191965 9 Left 1125191956 15:37003843-37003865 CCCTCACCCCTTCTGCCATATGA 0: 3
1: 25
2: 93
3: 280
4: 806
Right 1125191965 15:37003875-37003897 GAGACGGCTGTCTCTACACCGGG 0: 1
1: 0
2: 0
3: 4
4: 112
1125191957_1125191965 8 Left 1125191957 15:37003844-37003866 CCTCACCCCTTCTGCCATATGAG 0: 2
1: 25
2: 76
3: 281
4: 802
Right 1125191965 15:37003875-37003897 GAGACGGCTGTCTCTACACCGGG 0: 1
1: 0
2: 0
3: 4
4: 112
1125191955_1125191965 20 Left 1125191955 15:37003832-37003854 CCTGGAGAGCTCCCTCACCCCTT 0: 3
1: 45
2: 105
3: 268
4: 746
Right 1125191965 15:37003875-37003897 GAGACGGCTGTCTCTACACCGGG 0: 1
1: 0
2: 0
3: 4
4: 112
1125191962_1125191965 -6 Left 1125191962 15:37003858-37003880 CCATATGAGGACATATTGAGACG 0: 1
1: 2
2: 9
3: 118
4: 825
Right 1125191965 15:37003875-37003897 GAGACGGCTGTCTCTACACCGGG 0: 1
1: 0
2: 0
3: 4
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125191965 Original CRISPR GAGACGGCTGTCTCTACACC GGG Intronic
901434153 1:9235786-9235808 GAGACCACTGTCTCTACAAAAGG - Intronic
903031468 1:20466963-20466985 CAGGCCGCTGTCTCTGCACCTGG - Intergenic
903902666 1:26659384-26659406 CAGGCGCCTGTCACTACACCCGG + Intergenic
904682471 1:32239167-32239189 GACCAGGCTGTCTCTGCACCTGG + Intergenic
905742127 1:40380670-40380692 GAGACGCCTGCCACCACACCTGG + Intronic
1069373650 10:67772076-67772098 GAGACAGATGTCTTTACATCTGG - Intergenic
1072642377 10:97221637-97221659 AAGACGGCTGTCTGTGAACCAGG + Intronic
1074489586 10:113927233-113927255 GACTGGGCTTTCTCTACACCTGG - Intergenic
1076806948 10:132863469-132863491 GAGACGGGTGTGTGCACACCAGG - Intronic
1083880617 11:65546660-65546682 GAGAGGGCAGCCTCTACTCCCGG + Intronic
1093771491 12:23023107-23023129 GAGACGCCTGCCACTGCACCTGG + Intergenic
1102541840 12:113625900-113625922 GAGACAGGTGTCTCTACACTGGG + Intergenic
1102713712 12:114951922-114951944 AAGATGGCTGTCTATAAACCAGG + Intergenic
1112123704 13:96441100-96441122 AAGACTGCTGTCTGTAAACCAGG + Intronic
1114570413 14:23663355-23663377 GAGACAACTGTCTGTTCACCAGG + Intergenic
1114664053 14:24368266-24368288 GAGGCTGCTGTATCTTCACCCGG - Intronic
1121830941 14:97051810-97051832 AAGGCGGCTGTCTGTAAACCAGG - Intergenic
1122199336 14:100112971-100112993 GACAAGGCTCTCTCTCCACCTGG - Intronic
1125191965 15:37003875-37003897 GAGACGGCTGTCTCTACACCGGG + Intronic
1126154628 15:45553904-45553926 CAGGCACCTGTCTCTACACCTGG - Intergenic
1127174585 15:56339850-56339872 AAGATGACTGTCTCTAAACCAGG + Intronic
1127890585 15:63247127-63247149 GAGACAGCTGTCTACAAACCAGG - Intronic
1130712404 15:86296371-86296393 GAGAAGGCTGTATCTTCACCAGG - Intronic
1131968711 15:97871574-97871596 GAGGGGGCTTTCTCTACACGTGG - Intergenic
1132875484 16:2135258-2135280 GGGACGTCTGTCTCCAGACCCGG + Intronic
1134519501 16:14912102-14912124 GGGACGTCTGTCTCCAGACCCGG - Intronic
1134554433 16:15154132-15154154 GGGACGTCTGTCTCCAGACCCGG + Intergenic
1134707172 16:16310757-16310779 GGGACGTCTGTCTCCAGACCCGG - Intergenic
1134960368 16:18401367-18401389 GGGACGTCTGTCTCCAGACCCGG + Intergenic
1135040056 16:19111436-19111458 GAGACGGCTCTCTCTCCATGTGG - Intergenic
1135048906 16:19176691-19176713 GAGACGCCTATCTCTACAAGGGG - Intronic
1138037087 16:53619075-53619097 GACACGGGTGTCTCTTCAGCAGG + Exonic
1138100651 16:54249536-54249558 GAGACTGCTGTCTGCAGACCTGG + Intronic
1138221937 16:55259235-55259257 GAGGCGGCTGTTTTTCCACCTGG - Intergenic
1138579108 16:57928154-57928176 GAGAAGGCTGTGTGTACAGCTGG - Intronic
1140376539 16:74449564-74449586 GGGAAAGCTGTCTCTTCACCAGG + Intergenic
1140521810 16:75588301-75588323 AAGATGGCTGTCTATAAACCAGG - Intergenic
1146056758 17:29585204-29585226 GAGAGGGAGGTCTCCACACCTGG - Intronic
1159708106 18:71718239-71718261 CTGGCTGCTGTCTCTACACCAGG - Intergenic
1160054088 18:75463271-75463293 GAGGGGGTTGTCTCTACAACAGG - Intergenic
1167028362 19:46939150-46939172 GAGACCCCTGTGTCTACAGCAGG - Intronic
1168666848 19:58210855-58210877 CAGACAGCTGCCACTACACCCGG + Intronic
926426883 2:12746345-12746367 AAAACGGCTGTCTATCCACCAGG - Intergenic
929395202 2:41514511-41514533 AAGACCCCTGTTTCTACACCAGG + Intergenic
929722224 2:44382082-44382104 CAGACGCCTGCCACTACACCTGG + Intronic
935027904 2:99294957-99294979 CAGGCGCCTGTCACTACACCCGG - Intronic
935699509 2:105799447-105799469 GAGAAGGCTGTCTCTTCCCTGGG + Intronic
937162854 2:119782274-119782296 CAGGCGCCTGTCTCCACACCCGG - Intronic
939263284 2:139837562-139837584 CAGACGCCTGCCACTACACCTGG - Intergenic
939982895 2:148802101-148802123 GAGACGGCTGTCTATGAACTAGG - Intergenic
940372773 2:152921374-152921396 AAGACAGCTGTCTGTAAACCAGG - Intergenic
942707499 2:178793157-178793179 GAGACCCCTGTTTCTACTCCTGG + Intronic
944603899 2:201332084-201332106 AAGAGTGCTGTCTCTCCACCAGG + Intronic
1169228080 20:3868489-3868511 CAGACGTCTGCCACTACACCTGG - Exonic
1172771009 20:37382701-37382723 GAGACCCCTGACTCCACACCTGG + Exonic
1175536927 20:59721364-59721386 GACACGCCTGTCTCTCCCCCTGG + Intronic
1176016677 20:62937625-62937647 GAGACGGCTGACCCGAGACCGGG - Intronic
1176081860 20:63277533-63277555 GACACGGCTGTGTGCACACCTGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1179318212 21:40265048-40265070 TAGATGCCTGTCACTACACCTGG - Intronic
1180910858 22:19448930-19448952 GAGCCGGCTGCCTCAACAGCAGG - Intergenic
1181847602 22:25724770-25724792 GATACCGCTGTGTCTGCACCCGG + Exonic
1183717403 22:39541618-39541640 CAGGCGCCTGTCTCCACACCTGG + Intergenic
1184212396 22:43043704-43043726 GAGAAAGCAGTCTCCACACCAGG - Intronic
1184388177 22:44187983-44188005 GAGACAGGTGTCCCTAAACCCGG - Intronic
1184855953 22:47146866-47146888 GAGAGGGCTGTCTGCCCACCCGG + Intronic
950089982 3:10288528-10288550 GAGACGGCTAGCTCCACACATGG - Intronic
950268042 3:11589745-11589767 AAGGCGGCTGTCTCTAGGCCGGG - Intronic
953180012 3:40586105-40586127 GTGATGGCTGTCTCAATACCTGG + Intergenic
953349275 3:42202505-42202527 GAGGCGGCTGTCCCTGCGCCGGG + Exonic
954205791 3:49057866-49057888 GAGACTGCTGTACCTGCACCTGG + Exonic
955405707 3:58624493-58624515 GAGAACGCTGTCTCTCCTCCTGG + Intronic
955930948 3:64056212-64056234 GAGATGGCTATCTGTAAACCAGG + Intergenic
960165333 3:114395070-114395092 GAGACAGCTTTATCTTCACCTGG - Intronic
961734946 3:128995440-128995462 GAGACTGCTGTCTGTATGCCAGG + Intronic
963019250 3:140856625-140856647 TTGATGGCTTTCTCTACACCAGG + Intergenic
965464926 3:169017360-169017382 TAGACGGCTGTCTGCAAACCAGG - Intergenic
974796106 4:66752312-66752334 AACATGGCTGTCTTTACACCAGG - Intergenic
982199957 4:152950556-152950578 GAGACGCCTGCTTCTACAGCTGG + Intronic
985354390 4:189102233-189102255 GCGGGGGCTGTCTCTACACATGG + Intergenic
988739839 5:34059513-34059535 AAGACAGCTGTCTATAGACCAGG - Intronic
989556586 5:42803541-42803563 GAGGCGGCTTTCTTTAGACCTGG + Intronic
990698353 5:58447273-58447295 GAGAGGGCTGTCTCTTCTCTGGG + Intergenic
991584916 5:68192242-68192264 AAGACGCCTGTCACCACACCTGG + Intronic
996770069 5:127076404-127076426 CAGCAGGCTTTCTCTACACCAGG - Intergenic
998371162 5:141662254-141662276 GAGACGGCTGGCTCTCCTCAGGG - Exonic
1002811189 6:631108-631130 GAGAAGGCTGTCTGAATACCAGG + Intronic
1004441091 6:15655299-15655321 GAGACCCCTGTCTCTACAAAGGG - Intronic
1004927736 6:20431939-20431961 AAGATGGCTGCCTCTTCACCTGG + Intronic
1005980764 6:30834857-30834879 GAAACAGCTGTATCTGCACCTGG + Intergenic
1010212525 6:73373432-73373454 GAGACCTCTGTCTCTACAGTGGG - Intronic
1010891685 6:81320517-81320539 GAGACGGCTGATTCTGCACCTGG + Intergenic
1011947366 6:92923013-92923035 GAGAAGGCTGTATCTAGAACAGG - Intergenic
1021959786 7:25859775-25859797 GAGACGGGTCCCTCTACACACGG + Intergenic
1023408106 7:39857961-39857983 CAGACGCCTGTCACCACACCTGG + Intergenic
1024548553 7:50541609-50541631 AAGACGGCTGTCTGTAAACCAGG + Intronic
1025137755 7:56434577-56434599 CAGACGCCTGTCACCACACCTGG - Intergenic
1031213551 7:118861087-118861109 GAGATGACTGTCTATAAACCAGG - Intergenic
1031984238 7:128152700-128152722 GAGTAGGATGTCTCCACACCTGG - Intergenic
1032977036 7:137237265-137237287 AAGACAGCTGTCTATAAACCAGG + Intronic
1034293725 7:149952019-149952041 GAGAAGGCTGTCTGCAAACCGGG - Intergenic
1034812341 7:154144834-154144856 GAGAAGGCTGTCTGCAAACCGGG + Intronic
1038286842 8:26212835-26212857 AAGACGGCGGTCTCTGAACCAGG + Intergenic
1039722974 8:40184696-40184718 AAGACGGCTGTCTGTGAACCAGG + Intergenic
1045731478 8:105246876-105246898 AAGATGGCTGTCTATAAACCAGG + Intronic
1048281878 8:133111954-133111976 GGGATGGCTGACTCTCCACCCGG - Intronic
1049599785 8:143502098-143502120 AAGACAGCTGTCTGTAAACCCGG + Intronic
1049685027 8:143935874-143935896 GAGGCGGCCGTCTCTCCAGCTGG + Exonic
1051713433 9:19956904-19956926 AAGATAGCTGTCTATACACCAGG + Intergenic
1057180753 9:93028799-93028821 GAGACTGGGGTCTCTCCACCTGG + Intronic
1060093441 9:120765235-120765257 CAGACGGCTGCCACTGCACCTGG + Intronic
1061945591 9:133906831-133906853 GAGACCCATGGCTCTACACCGGG + Intronic
1186666543 X:11722603-11722625 GAGCCAGCTGTCTGCACACCTGG + Intergenic
1190663133 X:52673497-52673519 TTGAGGGCTTTCTCTACACCTGG + Intronic
1190676290 X:52784985-52785007 TTGAGGGCTTTCTCTACACCTGG - Intronic
1192594834 X:72395449-72395471 GGGACAGCTGTCTATACAGCTGG - Intronic
1200139726 X:153893719-153893741 AAGGTGGCTGTCTCTAAACCAGG + Intronic