ID: 1125192192

View in Genome Browser
Species Human (GRCh38)
Location 15:37006464-37006486
Sequence CTCCATCACAGCTTGATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125192192 Original CRISPR CTCCATCACAGCTTGATCCA TGG Intronic
901880752 1:12192480-12192502 CTCCAACACGACTTCATCCACGG + Exonic
904499520 1:30906228-30906250 CTCCTTGACAGCTTGACCCATGG + Intronic
905908933 1:41640555-41640577 ATCCATCACAGCCTGAGACATGG - Intronic
906529591 1:46515888-46515910 CTCCCTCAGAGCATGGTCCAGGG + Intergenic
907325753 1:53637818-53637840 GGCCATCACTGCTTGATACATGG - Intronic
907711427 1:56886091-56886113 TTACATCACATCTGGATCCATGG + Exonic
913022124 1:114798515-114798537 CTCCATCACAGATTAAAGCAGGG + Intergenic
915359904 1:155279597-155279619 CTCCAACACAGTTGGACCCACGG - Intronic
915433290 1:155883628-155883650 TTGCTTAACAGCTTGATCCAGGG + Exonic
917299708 1:173560548-173560570 CTACAGCACAGTTTCATCCAAGG - Intronic
919761049 1:201098480-201098502 CTCCATCATGGCCTGATACATGG - Intronic
922399706 1:225239358-225239380 CTCCCTCACTGCTTCTTCCATGG - Intronic
1063306928 10:4911025-4911047 CTCCCTCAGAGTTTGATCTAAGG - Intergenic
1067594345 10:47542790-47542812 CTCCATGCCTCCTTGATCCATGG - Intronic
1070138714 10:73719781-73719803 CTCCATGCCTCCTTGATCCATGG - Intergenic
1072328624 10:94323326-94323348 ATCTAACACAGCTTGATCTAGGG - Intronic
1072546874 10:96446870-96446892 CTCGTTCACTGCTGGATCCATGG - Intronic
1074141558 10:110677906-110677928 CTCCTTCACAGCTTAACCCTCGG + Intronic
1075870137 10:125766319-125766341 TTCCTTGACAGCTTGACCCAGGG + Intergenic
1076112613 10:127872495-127872517 CTCCATCACCGCTGGAGCCTGGG + Intergenic
1077532967 11:3105914-3105936 CTCCATCACAGCTGGGTCCAGGG + Intronic
1078596734 11:12693586-12693608 CGTCATCAAAGCTTAATCCATGG - Intronic
1078929475 11:15902101-15902123 CTACCTCCCAGCTTGATCCAGGG + Intergenic
1082764428 11:57155974-57155996 CTCCATCACATCCTGTTCCCGGG - Intergenic
1085028885 11:73257845-73257867 CTCCCTCCCAGCTTCAGCCATGG - Intergenic
1085126087 11:74003735-74003757 CTACATCCCAGGTTGACCCACGG + Intronic
1086933055 11:92714556-92714578 CTCAATCAAACTTTGATCCATGG + Intronic
1090672249 11:128956866-128956888 CTCCATGAGAGCTTGACACATGG - Intergenic
1090920578 11:131203012-131203034 CTGCCTCACAGATTGAGCCAAGG - Intergenic
1093708926 12:22307248-22307270 CTTCATCAGAGGTTGATCCACGG + Intronic
1097823634 12:64152842-64152864 CTCATTCACAGCTAGATCCCCGG - Exonic
1103742605 12:123101272-123101294 CTGCATCACAGGTTGGCCCAGGG - Intronic
1104664343 12:130636796-130636818 TTCAGTTACAGCTTGATCCAGGG - Intronic
1107058184 13:36129371-36129393 CTGGATCACAGGTTCATCCAGGG + Intronic
1108486786 13:50934898-50934920 ATCCACCACAACTTGATCAAGGG - Exonic
1109135615 13:58646168-58646190 TTCTATCACAGCCTGGTCCATGG - Intergenic
1113358497 13:109606221-109606243 ATGCATCACATCTTTATCCATGG + Intergenic
1113653069 13:112051084-112051106 CTCCATCACCCCTTGAGCCAGGG + Intergenic
1117066368 14:52016080-52016102 CTCCCTCACAGCTCACTCCATGG + Intronic
1118497030 14:66316880-66316902 CTACCTAACAGCTTGACCCAGGG - Intergenic
1121345621 14:93133601-93133623 TTCCAACACAACTTGATTCATGG - Intergenic
1125192192 15:37006464-37006486 CTCCATCACAGCTTGATCCATGG + Intronic
1125972068 15:43919984-43920006 CCCCTTCACAGCTGGCTCCATGG - Intronic
1126531582 15:49716534-49716556 CACCTTCACAGCTTGCTCAAAGG + Intergenic
1128475402 15:67993028-67993050 GGCCACCACAGCTTGATCAAAGG - Intergenic
1129313028 15:74725592-74725614 CTCCATCTCAGCTCGCTCCAGGG - Exonic
1131878985 15:96842414-96842436 CACTATCACTGCTTAATCCATGG - Intergenic
1132332618 15:101023235-101023257 ATCCATCACTGCTTGAACCCGGG + Intronic
1132524481 16:407510-407532 CTCCTTCAGAGCCTGGTCCACGG - Exonic
1133575581 16:7086052-7086074 CTCCATCACTGCTTGTTTTATGG + Intronic
1135723353 16:24835396-24835418 CTCCATCTCAACTTCAACCACGG + Intergenic
1135935501 16:26776609-26776631 CCCCGTCACAGCTTGTGCCAGGG - Intergenic
1135947985 16:26882217-26882239 CACCCTCACATCTTCATCCAGGG + Intergenic
1137802099 16:51270939-51270961 CTGCATGACAGCTTGATTCAGGG - Intergenic
1142105451 16:88299979-88300001 CTCCATCACAGCAGGCTCCCCGG - Intergenic
1143054550 17:4153160-4153182 TTACATCACAGTTTGATGCATGG - Intronic
1144773721 17:17773420-17773442 CTCCATCCCTGCTTGCTCCCAGG + Intronic
1144960148 17:19040165-19040187 CTCCCTGACAGCTTGGCCCAGGG + Intronic
1144975012 17:19134359-19134381 CTCCCTGACAGCTTGGCCCAGGG - Intronic
1147770488 17:42864669-42864691 CTCCTTCCCAAGTTGATCCAGGG + Intergenic
1148584697 17:48769094-48769116 CTCCAGCCCAACTGGATCCAAGG - Exonic
1149316306 17:55442162-55442184 CTGCATCACCGCTTGAACCCAGG - Intergenic
1149525872 17:57355368-57355390 ATCCATCACAGACTGGTCCAAGG - Intronic
1150651348 17:67012379-67012401 CTTCATCATAGCTTGAGCCCAGG + Intronic
1151283171 17:73091678-73091700 CTCCATCACAGCTTACACAATGG + Intronic
1151666316 17:75547033-75547055 CGCCATCACAGCTCGACCCCAGG + Intronic
1152328806 17:79658501-79658523 CTCCATCACACCTGCACCCATGG + Intergenic
1154962489 18:21323792-21323814 CTTCATCACACCTTCACCCATGG - Intronic
1156587178 18:38444345-38444367 CTCCCTCACAGCCTGATCCTGGG + Intergenic
1158131676 18:54159080-54159102 CTCCATCACAGTAGCATCCAGGG - Intronic
1160323016 18:77914110-77914132 CTCCATAACAGCTTCATTTAGGG + Intergenic
1162390527 19:10387039-10387061 CTCCATCACTGTGTGATCCTGGG + Intergenic
1164750757 19:30653187-30653209 CTGCATCATAGCAAGATCCATGG - Intronic
1167745829 19:51351359-51351381 TTCAGGCACAGCTTGATCCAGGG - Intronic
928673700 2:33629214-33629236 ATCTATCACTGTTTGATCCAAGG + Intergenic
929299450 2:40286507-40286529 GTCCATCAAAGGCTGATCCACGG - Intronic
932585876 2:73028444-73028466 CTGCCTCACAACTTGATGCATGG - Intronic
932688885 2:73895740-73895762 CTCCATCAAAACTTGCTCCCAGG - Intronic
934600284 2:95652026-95652048 CCCCATCACAGCTCACTCCAGGG - Intergenic
937695191 2:124801044-124801066 CCCCACCACACCTTGCTCCAGGG + Intronic
937993580 2:127677276-127677298 CTCCATGAGAGCCTGGTCCATGG - Intronic
943537599 2:189171897-189171919 TTCCCTCTCAGCTTCATCCATGG - Intronic
947739511 2:232478725-232478747 CTCCTTCACAGCGTGCTCCTTGG - Intergenic
948488198 2:238294497-238294519 CTCCATCACAGCTTGTTTACAGG - Intergenic
1173005343 20:39135747-39135769 TTCCATCACAGCCTCACCCAGGG - Intergenic
1173686879 20:44930255-44930277 CTCCATCACAGCTTGCTAAACGG + Intronic
1173686892 20:44930335-44930357 CTCCATCACAGCTTTCTCGCGGG + Intronic
1174274548 20:49394291-49394313 CTCCACCACTCCTTGATCTATGG - Intronic
1174322168 20:49750580-49750602 TTCCAGCACAGCTGGACCCAAGG + Intergenic
1174680081 20:52398306-52398328 GTCGATCCCAGCTTGAGCCAAGG + Intergenic
1176379696 21:6106069-6106091 CTCCATCTCAGCTGCATCTATGG - Intergenic
1178371792 21:32032716-32032738 CTTCATCTCATCTTCATCCAGGG + Intronic
1179743778 21:43432168-43432190 CTCCATCTCAGCTGCATCTATGG + Intergenic
1182449547 22:30410804-30410826 CTCCACCCCAGCTTGCTCCTGGG - Intronic
1184201838 22:42974906-42974928 CTCCACCCCAGATTGATGCAAGG + Intronic
953482868 3:43266841-43266863 GTACATCAGAGCTTTATCCAAGG + Intergenic
958662775 3:97092912-97092934 CTCCAACACAGCATGATTCAGGG + Intronic
959568177 3:107853903-107853925 CTCCATGACAACCTCATCCAGGG - Intergenic
961541073 3:127599660-127599682 TTTGAGCACAGCTTGATCCAGGG + Intronic
962391707 3:134977889-134977911 CTCCTTCACAGGTAGAACCAGGG - Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
966341847 3:178933997-178934019 CTCAATCCCAGCTTGAACCCAGG - Intergenic
974049867 4:56930756-56930778 CTCCATCTGAGCATGCTCCATGG - Exonic
975880012 4:78893880-78893902 CACAATTACTGCTTGATCCATGG + Intronic
977194545 4:94043309-94043331 CTCCATCACTTCTAGATCCCTGG - Intergenic
978647997 4:110964038-110964060 CTCCATTCCAGCTGCATCCACGG - Intergenic
986485764 5:8235167-8235189 CTACATCACTTCTTGATTCATGG + Intergenic
986728686 5:10618931-10618953 CTTCATCTCAGCTTGTTACACGG - Intronic
1001446247 5:171786086-171786108 CTCCATCAGAGTGGGATCCAGGG - Intronic
1001807008 5:174595482-174595504 CTCCATCCCAGCTCCTTCCAGGG + Intergenic
1001950530 5:175813584-175813606 GCCCATCAGAGCTGGATCCATGG - Intronic
1003527902 6:6913277-6913299 TTCCTTCACCACTTGATCCAGGG + Intergenic
1005343126 6:24862266-24862288 CTCCATTGAAGCTTGATGCAGGG + Intronic
1007596120 6:43052465-43052487 CTCCAGCACAGATTTGTCCAGGG + Exonic
1012673190 6:102082589-102082611 CTCCATCACAGTTTTTTCCTGGG - Intergenic
1019491300 7:1314781-1314803 CTCCACCACAGCTGGAGGCAGGG - Intergenic
1022989463 7:35694310-35694332 CTCCATCCCACTTTGGTCCATGG + Exonic
1024279470 7:47707531-47707553 TTCCATCACGGCTCTATCCATGG - Intronic
1037280266 8:17233306-17233328 GTGCATCACAGCTTGAAACAAGG + Intronic
1038120139 8:24603890-24603912 ATCCATCATAGCTGGCTCCAGGG + Intergenic
1038336494 8:26649828-26649850 CTCCATCAAACCATGATGCAGGG - Intronic
1039720053 8:40153738-40153760 CTCCTCCACATCTTGATCTATGG - Exonic
1041896129 8:62926516-62926538 CTTCATCACTGCTTTCTCCAAGG + Intronic
1042705107 8:71658613-71658635 CTTAAGCACAGCTGGATCCAAGG + Intergenic
1044138218 8:88613596-88613618 CAACATCACATCTTAATCCATGG - Intergenic
1045941531 8:107744769-107744791 CTCCATCACAACTTACTTCAAGG - Intergenic
1046275270 8:111950793-111950815 CTCCATCACACCTTGATTTTAGG + Intergenic
1050845437 9:10211458-10211480 ATGCCTCACAGCTTCATCCATGG - Intronic
1053278676 9:36802249-36802271 CACAATCAGAGCTTGTTCCATGG - Intergenic
1055710998 9:79062022-79062044 CTTCATCAGAACTTCATCCAAGG + Intergenic
1055831789 9:80388109-80388131 CTCCATCAGAGCATGCTCAAAGG - Intergenic
1058750948 9:108037736-108037758 CTCCCTCACAACTTGTTCCCTGG - Intergenic
1061923973 9:133797049-133797071 CTCCACCACTGCTAGAGCCAGGG + Intronic
1187775715 X:22754357-22754379 CTCCACACCAGCTTGAACCAGGG - Intergenic
1188589084 X:31812690-31812712 CTAAATCACTGCTTGATACATGG + Intronic
1190822793 X:53989813-53989835 CTCATACAGAGCTTGATCCATGG + Intronic
1192268582 X:69557360-69557382 CTCCATCACTTATTGTTCCAGGG - Intergenic
1199081478 X:143580990-143581012 CTCCAGTACAGCATGAACCAAGG - Intergenic
1200096319 X:153665761-153665783 CCCCACCCCAGCTTCATCCACGG - Intergenic