ID: 1125193065

View in Genome Browser
Species Human (GRCh38)
Location 15:37015746-37015768
Sequence TGCTCTATGTTGCACTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125193065_1125193066 -6 Left 1125193065 15:37015746-37015768 CCTGTGCAGTGCAACATAGAGCA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1125193066 15:37015763-37015785 AGAGCACCAGTGCAAACAAAAGG 0: 1
1: 0
2: 1
3: 21
4: 179
1125193065_1125193067 -3 Left 1125193065 15:37015746-37015768 CCTGTGCAGTGCAACATAGAGCA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1125193067 15:37015766-37015788 GCACCAGTGCAAACAAAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 153
1125193065_1125193070 18 Left 1125193065 15:37015746-37015768 CCTGTGCAGTGCAACATAGAGCA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1125193070 15:37015787-37015809 GGGAATTTTGCAGCTTCACGAGG 0: 1
1: 0
2: 0
3: 4
4: 86
1125193065_1125193068 -2 Left 1125193065 15:37015746-37015768 CCTGTGCAGTGCAACATAGAGCA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1125193068 15:37015767-37015789 CACCAGTGCAAACAAAAGGAGGG 0: 1
1: 0
2: 3
3: 29
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125193065 Original CRISPR TGCTCTATGTTGCACTGCAC AGG (reversed) Intronic
901332351 1:8420594-8420616 TGCTGTCTTTTGCATTGCACTGG - Intronic
903912728 1:26739733-26739755 TGCTCTATGGTGCTCATCACTGG + Intronic
903940894 1:26930514-26930536 TGCTCTATGTTGGACCAGACTGG - Intronic
906108631 1:43309081-43309103 AGCTCTATGCTGCCCCGCACGGG - Exonic
909980088 1:82089082-82089104 AGCTCTATGCTGCCCTGCATTGG - Intergenic
914329771 1:146656097-146656119 TGCTCTATGTTATACTACAAAGG - Intergenic
915091646 1:153430290-153430312 TCCTCTACTGTGCACTGCACTGG - Intergenic
918239709 1:182610866-182610888 TGCTCCAGTTTGCTCTGCACTGG - Intergenic
919500690 1:198334585-198334607 TGCTAAATGTTACAATGCACAGG + Intergenic
921640807 1:217551218-217551240 TGCTCTTTGTAGGCCTGCACCGG + Intronic
921816089 1:219565174-219565196 TGCTCTATAATGCATTGGACTGG - Intergenic
1066101950 10:32125296-32125318 TGCTGTCTGTTCCACTACACTGG - Intergenic
1066480341 10:35789462-35789484 TTCTCTGTAATGCACTGCACGGG + Intergenic
1070388226 10:75946384-75946406 TGCTCCATGTCTCCCTGCACAGG - Intronic
1071165038 10:82796351-82796373 TGCTCTATGGTGGACTTGACAGG - Intronic
1073088023 10:100907797-100907819 TGCTCTCTGTAATACTGCACTGG + Intergenic
1073352043 10:102826965-102826987 TGCTCTAGGATGCAGTGCAGTGG + Intergenic
1075686607 10:124368736-124368758 TGCTCTGTGATGAAGTGCACAGG - Intergenic
1080054449 11:27891506-27891528 TGCTCCAGGTTGCAGTGCAATGG + Intergenic
1086420148 11:86630814-86630836 TACTCTGTGTGGCACTGCACAGG - Intronic
1087266323 11:96065830-96065852 TGCTCTGTGCTGCCTTGCACTGG + Intronic
1089807343 11:121103240-121103262 TTCTCTGTGTAGCACTGCCCTGG + Intronic
1094013198 12:25830731-25830753 CGCACTATCTTGCAATGCACGGG + Intergenic
1094361586 12:29637018-29637040 TGCTCTAGGCTGCAGTGCAGTGG - Intronic
1096812368 12:54179491-54179513 TGCGCCATGTTGCAGAGCACTGG - Intronic
1098483774 12:70997106-70997128 AGCTCCATGCTGCACTGCAAGGG + Intergenic
1099855143 12:88155325-88155347 TACTACATGATGCACTGCACAGG - Intronic
1104401037 12:128476367-128476389 TGCTTTATTCTGCATTGCACAGG - Intronic
1104877840 12:132048891-132048913 TACTCTATGTTTCTGTGCACAGG - Intronic
1105270223 13:18866358-18866380 TTCCCTCTGTTGCTCTGCACTGG - Intergenic
1105406867 13:20140256-20140278 TGCTGTAGGATGCACTGGACAGG - Exonic
1111309017 13:86457034-86457056 TGCTCTATTCTGCACTTCACAGG + Intergenic
1111967753 13:94878130-94878152 TGCTCTCTCTTCGACTGCACAGG + Intergenic
1114799276 14:25754670-25754692 TGCTCTTTATTGAACAGCACAGG + Intergenic
1118098464 14:62567109-62567131 TGCTCTATGTTCCCATTCACTGG + Intergenic
1121782603 14:96631583-96631605 TGCTCAAAGTTGCAGTGGACAGG - Intergenic
1125193065 15:37015746-37015768 TGCTCTATGTTGCACTGCACAGG - Intronic
1128926038 15:71657087-71657109 TGCTCTATGTCGTGCTGGACAGG - Intronic
1129490462 15:75920386-75920408 TGGGCTATGTTGCCCTGGACTGG - Intronic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1132076870 15:98828873-98828895 TGCTCGATTTTACAATGCACTGG - Intronic
1133755368 16:8758598-8758620 TGCTCAATGTCTCAATGCACAGG - Intronic
1138302518 16:55944446-55944468 TGGTCTGAGTGGCACTGCACAGG - Intronic
1140003789 16:71054836-71054858 TGCTCTATGTTATACTACAAAGG + Intronic
1141201378 16:81900880-81900902 TGCTCCAGGTCCCACTGCACAGG + Intronic
1148516750 17:48226041-48226063 TGGTCTATGTTCCTCTGCCCTGG - Intronic
1151791227 17:76307274-76307296 TGCTCTACCTTGCAGTCCACGGG - Intronic
1152274366 17:79347048-79347070 CTCTCTTTGTTGCACTGCATAGG + Intronic
1153190808 18:2535797-2535819 TGCTCTTTGTTGAATTCCACAGG - Intergenic
1154035849 18:10800904-10800926 TGCCCTATGTGGCTCTGCACAGG + Intronic
1154417818 18:14193621-14193643 TTCCCTCTGTTGCTCTGCACTGG + Intergenic
1155732949 18:29184510-29184532 TGCTCTATGCTGAAGTTCACAGG + Intergenic
1157028587 18:43877068-43877090 TGCTCTGTGTAGCAGAGCACAGG + Intergenic
1158113760 18:53971821-53971843 TGCTCTATGTATCTCTTCACTGG + Intergenic
1167016014 19:46841655-46841677 TCCTCCATGTTGCCCTGCAAAGG + Intronic
1168680048 19:58308254-58308276 TCCTTTAATTTGCACTGCACAGG - Intronic
925295011 2:2770381-2770403 TGCTCCATGCAGCTCTGCACTGG + Intergenic
930614964 2:53584181-53584203 TGTTCTATCTTGTACTGCATAGG - Intronic
933086694 2:78061956-78061978 TGCTGTAGCTGGCACTGCACTGG - Intergenic
936030801 2:109068630-109068652 TCCCCTCTGTTGCACTGCCCAGG - Intergenic
936562465 2:113553184-113553206 TGATCAATGTTGTACTGAACCGG - Intergenic
940027568 2:149224622-149224644 TGCTCTTTGTTCCATTGCTCTGG + Intergenic
947791000 2:232869307-232869329 AGCTCTATGTTTCAGTCCACTGG - Intronic
1169630580 20:7626157-7626179 TGCTCCATGGGGCAGTGCACCGG - Intergenic
1173993301 20:47319277-47319299 GGCTCTTCGGTGCACTGCACCGG - Intronic
1176328227 21:5520611-5520633 TGCTTTATGTTTGCCTGCACTGG - Intergenic
1176399530 21:6300340-6300362 TGCTTTATGTTTGCCTGCACTGG + Intergenic
1176437627 21:6688764-6688786 TGCTTTATGTTTGCCTGCACTGG - Intergenic
1176461889 21:7015834-7015856 TGCTTTATGTTTGCCTGCACTGG - Intergenic
1176485450 21:7397612-7397634 TGCTTTATGTTTGCCTGCACTGG - Intergenic
1180957903 22:19749465-19749487 TGCTCTCTGCTGCTCTACACAGG + Intergenic
1182759146 22:32707966-32707988 TGATCTATGCTGCAGAGCACTGG - Intronic
1182907634 22:33951702-33951724 TGCTCTTTGTTGGACTGGCCTGG - Intergenic
1183321174 22:37166123-37166145 GTCTCTCTGTTGCACTGGACAGG + Intronic
1184570606 22:45321907-45321929 TGCTCTAAGGTGCAGAGCACTGG - Intronic
949926802 3:9048154-9048176 TGCTCTGAGGTGCACTGCTCTGG - Intronic
951391664 3:22111796-22111818 AGCTCTATGTTTCACTGTTCAGG - Intronic
952529397 3:34248038-34248060 TTGTCTTTGTTGCACTCCACAGG + Intergenic
953744877 3:45566743-45566765 TGCTCTCTGTTCTCCTGCACAGG - Intronic
957187748 3:76964786-76964808 TGCTCTAGGCAGAACTGCACTGG + Intronic
957411438 3:79846641-79846663 TGCTCCATGTTGCTGAGCACTGG - Intergenic
963822809 3:149917366-149917388 TTCTGTTTCTTGCACTGCACGGG + Intronic
966088866 3:176105860-176105882 TGCTCTGTTTTGCAATGCAGAGG + Intergenic
969555614 4:7907050-7907072 TTCTCTGTGTTGCATAGCACAGG - Intronic
972366680 4:38382373-38382395 TGCTCTCATTTTCACTGCACAGG + Intergenic
974394118 4:61313288-61313310 TACTCTATATGGCACTGCAATGG + Intronic
975528573 4:75377501-75377523 TGCTCTTTGTTTCATTCCACAGG + Intergenic
988354537 5:30156126-30156148 GGCTATATTTTGCACTGTACTGG + Intergenic
993606579 5:89997824-89997846 TGCTCTCTGTTGGGATGCACTGG + Intergenic
994881739 5:105506632-105506654 TCCTCTATGATCAACTGCACTGG - Intergenic
995993664 5:118272812-118272834 TGTTCTATTTTGCAGTTCACTGG - Intergenic
997512481 5:134463176-134463198 TGCTGTATCTTGCACAGCAAAGG - Intergenic
1001207486 5:169777909-169777931 TTCTCTAAGTTGGAATGCACAGG - Intronic
1011806652 6:91079958-91079980 TGCTGTATTTTCCACTGCACAGG - Intergenic
1012111278 6:95238145-95238167 TGCTCTGTGTTGAAAGGCACTGG - Intergenic
1015804245 6:137092390-137092412 TGCTCTTCCCTGCACTGCACAGG - Intergenic
1024017152 7:45327473-45327495 GGCACTGTGTTGCACTGCACAGG - Intergenic
1024386398 7:48756809-48756831 TGCTCTATGTTGACCTTCAGTGG - Intergenic
1028019938 7:85757527-85757549 AGGTCTATGTTGCACAGGACTGG - Intergenic
1028823321 7:95238668-95238690 TTTGCTATGTTGTACTGCACTGG + Intronic
1041273271 8:56130686-56130708 TGCCTTATTTTGCACTGCATAGG - Intergenic
1044339032 8:91025869-91025891 TGCTCTGTATTGAACTGAACTGG - Intronic
1051165947 9:14262096-14262118 GGCACTAAGATGCACTGCACCGG + Intronic
1051191967 9:14522656-14522678 TGCTCTAGCATGCACTGCAGGGG - Intergenic
1051744927 9:20286560-20286582 TGCTCTATGTTATGCTGCAAGGG + Intergenic
1054696772 9:68368385-68368407 TGATCAATGTTGTACTGAACCGG - Intronic
1059042918 9:110833527-110833549 TGCCCTTCCTTGCACTGCACAGG - Intergenic
1060360129 9:122948009-122948031 TGAACTTTGTTTCACTGCACTGG - Intronic
1203433878 Un_GL000195v1:119858-119880 TGCTTTATGTTTGCCTGCACTGG + Intergenic
1187758223 X:22548828-22548850 TGCTCTCTGTTCCACAGCAAAGG - Intergenic
1197015793 X:121624956-121624978 TGCCCTAAGTTGCACTGCTGTGG - Intergenic