ID: 1125193425

View in Genome Browser
Species Human (GRCh38)
Location 15:37019703-37019725
Sequence GAAACGCAGGGCCCAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125193417_1125193425 29 Left 1125193417 15:37019651-37019673 CCGTAGAGGGTAGGGAGAGCATA 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1125193425 15:37019703-37019725 GAAACGCAGGGCCCAACAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 117
1125193416_1125193425 30 Left 1125193416 15:37019650-37019672 CCCGTAGAGGGTAGGGAGAGCAT 0: 1
1: 1
2: 1
3: 10
4: 138
Right 1125193425 15:37019703-37019725 GAAACGCAGGGCCCAACAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125193425 Original CRISPR GAAACGCAGGGCCCAACAGC AGG Intronic
900525871 1:3128436-3128458 GAAACGCAGGTCACAGTAGCAGG + Intronic
901211189 1:7526931-7526953 GAAACACAGGCCCCAGCAGCTGG - Intronic
901936689 1:12631603-12631625 GAACTGCAGGGCCCAAAAGAGGG - Intergenic
903078061 1:20787172-20787194 GTAACGCAGGACCGAACAGGCGG - Intronic
903138891 1:21326853-21326875 GAGACGCAGGGGCCAAAGGCTGG - Intronic
908697774 1:66864455-66864477 GAAACGCAGGTGTCAACAGATGG + Intronic
912501121 1:110122468-110122490 GAACCGCAGGGCCAAGCAGCAGG - Intergenic
915511606 1:156389829-156389851 GGAAGGCAGGGCCCCACCGCTGG + Intergenic
916966039 1:169944405-169944427 GAACCGCAGAGCCCCACAGAGGG + Intronic
920865383 1:209747967-209747989 CAAACGTAGGCCCCAGCAGCCGG - Intergenic
921164458 1:212496559-212496581 GGAAGGCAGGGCCCCAGAGCAGG - Intergenic
922744530 1:228036824-228036846 GCAGCCCAGGGCCCAGCAGCTGG + Intronic
924646072 1:245878336-245878358 GAAAGGCAGACCCCAACAGATGG + Intronic
1067299205 10:44993766-44993788 GAAAAGCAGGGCCTGCCAGCAGG + Exonic
1067380734 10:45770904-45770926 GAAACGCTGAGCACAAGAGCTGG + Intronic
1069593050 10:69653656-69653678 GAACCGCAGGGCCCCAAAGAGGG - Intergenic
1074084009 10:110193593-110193615 GTAAAGCAAGACCCAACAGCTGG - Intergenic
1075157291 10:119988929-119988951 GAAGCTCAAGGCCCCACAGCTGG + Intergenic
1078215801 11:9311129-9311151 GCCACTCAGGGCTCAACAGCAGG + Intronic
1080424125 11:32140456-32140478 GAAGGGCAGAGGCCAACAGCAGG - Intergenic
1080735119 11:35006556-35006578 GAAACCCAGGGCCCCACTCCTGG + Intronic
1082179137 11:49097779-49097801 GAAATGCAGGGGCCAACTGAAGG - Intergenic
1083297336 11:61722064-61722086 GAGAGGAAGGGCCCAGCAGCTGG - Intronic
1090766844 11:129883733-129883755 CAAACCCAGGGCCCAACTCCTGG + Intronic
1096212299 12:49776071-49776093 GAAACGCTGAGCCAGACAGCAGG - Intergenic
1096709693 12:53446187-53446209 GCCACTCAGGGCTCAACAGCAGG - Exonic
1101927669 12:108986042-108986064 GAAATGCAGGGCCCAGCACAGGG + Intronic
1103027558 12:117586073-117586095 CAAACAGAAGGCCCAACAGCAGG + Intronic
1103414553 12:120735428-120735450 GAAAGGCAGAGCCCAGCACCTGG - Intronic
1104157629 12:126148971-126148993 GAAACTCTGGGTCCAATAGCAGG - Intergenic
1104682604 12:130761852-130761874 CAAACCCAGGGCCCAGCAGATGG + Intergenic
1109077118 13:57850205-57850227 GAGAAGTAGGTCCCAACAGCAGG + Intergenic
1110810755 13:79808496-79808518 GAAATGCAGGGCCCCAAAGAAGG - Intergenic
1113615336 13:111676436-111676458 GCAAAGCAGTGCCCAACTGCTGG - Intergenic
1113620803 13:111761349-111761371 GCAAAGCAGTGCCCAACTGCTGG - Intergenic
1118431256 14:65720775-65720797 GAAACTCAGGCTCCAACCGCTGG + Intronic
1121001444 14:90454456-90454478 GAAAGGCAGAGCCCCAGAGCAGG + Intergenic
1121699758 14:95943747-95943769 GGAAAGAAGGGCCCAACAGAAGG - Intergenic
1122054467 14:99083766-99083788 GAACAGCAGGTCTCAACAGCAGG + Intergenic
1122323451 14:100868856-100868878 GGAAGCCAGGGCCCAAGAGCTGG - Intergenic
1123056925 14:105575119-105575141 GCATCTCTGGGCCCAACAGCAGG + Intergenic
1123081285 14:105696666-105696688 GCATCTCTGGGCCCAACAGCAGG - Intergenic
1124512460 15:30338938-30338960 TACACGCAGGGCACACCAGCGGG + Intergenic
1124730454 15:32191813-32191835 TACACGCAGGGCACACCAGCGGG - Intergenic
1125193425 15:37019703-37019725 GAAACGCAGGGCCCAACAGCAGG + Intronic
1125423958 15:39531395-39531417 GACACTCAGAGCCCAGCAGCAGG - Intergenic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1140427728 16:74874983-74875005 GAAACCCAGTGCCCTACAGCAGG + Intronic
1141897111 16:86965129-86965151 GACAGGCAGGGCTCCACAGCAGG + Intergenic
1143600995 17:7945907-7945929 GAAAAGAGGGGCCCAACAGGAGG - Exonic
1143660562 17:8322148-8322170 GAAACACTGGGCCAAACAGTGGG + Exonic
1149884760 17:60328709-60328731 GAACCGCAGGGCCCCAAAGAGGG - Intronic
1157246062 18:46056298-46056320 GAAGCACAGGGCACAACAGAGGG - Intronic
1157664067 18:49470353-49470375 GCCACTCAGGGCTCAACAGCAGG - Intergenic
1157766674 18:50302603-50302625 GACACGCAGGGCCCGACTTCTGG - Intergenic
1158708570 18:59817004-59817026 GAAAGGAAGAGCACAACAGCAGG + Intergenic
1160531585 18:79568113-79568135 GAAACTCAGAGCCCAGAAGCCGG - Intergenic
1160806666 19:995029-995051 GAAACGCAGGGCTCAGGACCAGG + Intronic
1161056106 19:2191382-2191404 GAAAGGAACGGCCCCACAGCGGG - Intronic
1161723777 19:5917203-5917225 CAAAGGCAGGGCCCCACAGCAGG + Exonic
1162183841 19:8889293-8889315 GAGATGCAGAGCCCATCAGCAGG - Intronic
1163509132 19:17725057-17725079 GAGAGGCAGGGTCCAACAGAAGG - Exonic
1166011028 19:39943085-39943107 GCCACTCAGGGCTCAACAGCAGG + Intergenic
1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG + Intergenic
927826227 2:26311870-26311892 GAAACGTGGGTCCAAACAGCTGG + Exonic
929686995 2:44043681-44043703 CAAAGGCAGGGCCCAATTGCTGG + Intergenic
931500174 2:62856311-62856333 GAACCACAGGGCCCCAAAGCGGG - Intronic
932522539 2:72428336-72428358 GAAACACAGGGCCCCAAAGAGGG - Intronic
935677104 2:105604604-105604626 GAAGCTCAGGTCCCAACACCAGG + Intergenic
936516985 2:113187176-113187198 GAAGCGCAGGGCCCCAGACCTGG - Intronic
937249789 2:120515974-120515996 GCAGTGCAGGGCCCAACAACAGG - Intergenic
937990022 2:127657067-127657089 CAACCGCATGGCCCACCAGCTGG - Intronic
943791345 2:191935566-191935588 GAAATGGAGGGCCAAAAAGCAGG + Intergenic
945843063 2:214911142-214911164 AAAACTCTGGGTCCAACAGCAGG - Intergenic
1175813988 20:61874155-61874177 GAAAAGCAGGGACCACCCGCTGG + Intronic
1180025944 21:45162187-45162209 GAACCGCAGGGCCCCAAAGGGGG - Intronic
1182468979 22:30535503-30535525 GAAACTGAGGGCCCAACAGAAGG + Intronic
1183094202 22:35542389-35542411 GAAACCCAGGGCCACACAGGGGG + Intronic
1183231855 22:36587412-36587434 GAAGGGCAGGGCCCACCACCAGG + Intronic
1184695783 22:46138395-46138417 GAGACCCTGGGCCCAACACCTGG - Intergenic
1184869341 22:47225400-47225422 GAACCGCAGGGCCCCAAAGAGGG + Intergenic
949444609 3:4120580-4120602 GAAATTCAAGGCCAAACAGCTGG + Intronic
953947667 3:47163644-47163666 CCAACGCCGGGCCCAACCGCGGG + Intronic
956344710 3:68265651-68265673 GAAAAGCATGGCCTTACAGCTGG + Intronic
961425241 3:126840253-126840275 GAAACTCTGTGTCCAACAGCAGG - Intronic
962483154 3:135815435-135815457 GAGACCCAGCACCCAACAGCTGG + Intergenic
963483450 3:145904926-145904948 GAACCGCAGGGCCCTAAAGAGGG - Intergenic
963917296 3:150870832-150870854 GAAACACAGGCCCCCACACCAGG - Intergenic
965475702 3:169152407-169152429 GAAGTGCAGGGCACAGCAGCAGG - Intronic
968793584 4:2687046-2687068 GACACTCAGGACTCAACAGCAGG - Intronic
969203890 4:5627331-5627353 GAATTGAAGGGCCCACCAGCTGG - Intronic
969226055 4:5799007-5799029 GCAGCGCAGGGCCTAACAGCAGG - Intronic
985783224 5:1881592-1881614 GAAACGCAGTGGCCACCTGCCGG + Intronic
986229816 5:5852917-5852939 GAAAAGCAGGTCCCCACAGGAGG + Intergenic
992002018 5:72445144-72445166 GAATCACTGTGCCCAACAGCAGG - Intronic
997521328 5:134526026-134526048 GATGCGCAGGGCCCATCCGCCGG - Intronic
997584963 5:135038701-135038723 CAAAGGCAGGGCCCCAAAGCCGG - Intronic
997926085 5:138032659-138032681 GAAACGCAACGCCCGAGAGCAGG + Intronic
1007745147 6:44039109-44039131 GGAACACAGGGCAGAACAGCCGG + Intergenic
1011291252 6:85779574-85779596 GAAACTCAGGTTCCAGCAGCTGG + Intergenic
1011470281 6:87701621-87701643 GGGACGCCGGGCTCAACAGCGGG + Exonic
1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG + Intergenic
1015377376 6:132526381-132526403 GACAGACAGGGCCCAACAGGGGG + Intergenic
1016982597 6:149866492-149866514 GCAATGCAGGGCCCAAGAGAAGG + Intergenic
1019464803 7:1181710-1181732 GCAACTCAGGGCCCAGCAGGCGG + Intergenic
1019574974 7:1733271-1733293 GACACGCAGTGCCCGACAGGTGG + Intronic
1019747717 7:2709839-2709861 GGAGCGCAGGTCCCAGCAGCCGG - Intronic
1020142793 7:5621785-5621807 GAAACCCAGGGCCGGACAGGAGG + Intronic
1021040587 7:15857298-15857320 AAAATGCAGGGCTAAACAGCTGG - Intergenic
1024369201 7:48560178-48560200 GAAACTCAGGTTCCAACTGCTGG + Intronic
1024670927 7:51593957-51593979 GAAACACATGGCCACACAGCTGG - Intergenic
1030334593 7:108311045-108311067 GAAACGCTTGGCTCAACAGCAGG - Intronic
1031928653 7:127662730-127662752 GGAGCGCAGGGCCCAGCACCTGG + Intronic
1046693852 8:117316390-117316412 GAAGCTCAGATCCCAACAGCTGG - Intergenic
1046961837 8:120121401-120121423 GAAACGAAGTGCTTAACAGCTGG + Intronic
1048062882 8:130938507-130938529 GAAAAGGAGGGCCCCAGAGCTGG + Intronic
1050475842 9:6040249-6040271 GAAACAAAGGGCACACCAGCTGG - Intergenic
1053426875 9:38015976-38015998 GAAGCGCAGGGGCTCACAGCTGG - Intronic
1055073973 9:72194791-72194813 GAAACTCAAGTCCCAACTGCTGG + Intronic
1056592282 9:87973466-87973488 CTAACGGAGGGCCCAAGAGCTGG + Intronic
1058833021 9:108836301-108836323 GAAAAGCTGGGCCCCACAGCTGG + Intergenic
1058935120 9:109763107-109763129 GAGAAGCAGGTCCCAAAAGCAGG + Intronic
1060901191 9:127259600-127259622 GAGACCCAGGGCCAAGCAGCAGG - Intronic
1062585230 9:137246242-137246264 CACACGCAGGGCCCACCAGGAGG + Intronic
1196399019 X:115294345-115294367 GAAACTCAGGCCCCAAGAGATGG - Intronic
1201063690 Y:10069820-10069842 GCAAGGCAGTGCACAACAGCAGG - Intergenic