ID: 1125193808

View in Genome Browser
Species Human (GRCh38)
Location 15:37023655-37023677
Sequence GTGCTGAGACTGCCTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125193804_1125193808 10 Left 1125193804 15:37023622-37023644 CCTGTTGTCTGCTTTAGTCCCTC 0: 1
1: 0
2: 2
3: 25
4: 162
Right 1125193808 15:37023655-37023677 GTGCTGAGACTGCCTGAGAAAGG 0: 1
1: 0
2: 0
3: 28
4: 193
1125193806_1125193808 -8 Left 1125193806 15:37023640-37023662 CCCTCTTGCTCTTTGGTGCTGAG 0: 1
1: 0
2: 4
3: 16
4: 214
Right 1125193808 15:37023655-37023677 GTGCTGAGACTGCCTGAGAAAGG 0: 1
1: 0
2: 0
3: 28
4: 193
1125193807_1125193808 -9 Left 1125193807 15:37023641-37023663 CCTCTTGCTCTTTGGTGCTGAGA 0: 1
1: 0
2: 2
3: 28
4: 196
Right 1125193808 15:37023655-37023677 GTGCTGAGACTGCCTGAGAAAGG 0: 1
1: 0
2: 0
3: 28
4: 193
1125193802_1125193808 23 Left 1125193802 15:37023609-37023631 CCCTTAGGTTTTTCCTGTTGTCT 0: 1
1: 0
2: 1
3: 39
4: 430
Right 1125193808 15:37023655-37023677 GTGCTGAGACTGCCTGAGAAAGG 0: 1
1: 0
2: 0
3: 28
4: 193
1125193803_1125193808 22 Left 1125193803 15:37023610-37023632 CCTTAGGTTTTTCCTGTTGTCTG 0: 1
1: 0
2: 0
3: 33
4: 323
Right 1125193808 15:37023655-37023677 GTGCTGAGACTGCCTGAGAAAGG 0: 1
1: 0
2: 0
3: 28
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125193808 Original CRISPR GTGCTGAGACTGCCTGAGAA AGG Intronic
900923762 1:5690428-5690450 GTGCTGAGAGTGGCTGGGACAGG - Intergenic
904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG + Intergenic
904670401 1:32160605-32160627 GTGCCCAGACTGCCTGAAAAGGG - Exonic
904756836 1:32772544-32772566 GGTCTGAGAATGCCTGGGAAGGG + Intronic
905065557 1:35178443-35178465 GTGGTCAGCCTGCCTGACAATGG - Intronic
905874148 1:41421769-41421791 GTTCTGAGAGTGCCTGAGCCAGG + Intergenic
906482062 1:46205676-46205698 GGCCTGAGGCTGCCCGAGAAAGG + Intronic
907898677 1:58717604-58717626 GGGCTGAGACTGCCTGGGCCTGG + Intergenic
912841550 1:113043693-113043715 GGGCTGAGAAGGGCTGAGAAGGG - Intergenic
913211788 1:116588630-116588652 GTGCAGAGACTGCCTGGGGGTGG - Intronic
915185813 1:154104476-154104498 CTGCTGCCACTGCCTGGGAAAGG - Intronic
919835460 1:201570240-201570262 CTGCTGAGTCTGCCCTAGAAGGG - Intergenic
921955405 1:220978341-220978363 GTGTTGGGCCTGCCTGAGAATGG + Intergenic
922740376 1:228011001-228011023 GTGCAGACACTGGCTGAGCAGGG - Intronic
923250830 1:232178393-232178415 GTGCTGAGTCTGCCTCTGGATGG - Intergenic
923672006 1:236049033-236049055 GTGCTCAGTCTTACTGAGAAAGG - Intronic
1063780492 10:9316877-9316899 CTGTTGAGTCTGCCTGTGAATGG + Intergenic
1067440627 10:46307561-46307583 TTTCTGGGACTGCCTGGGAACGG - Intronic
1068623506 10:59212464-59212486 CTGCTGGGATTGCCTGAGACTGG - Intronic
1069572207 10:69501095-69501117 GGGCTGCCACTGCCTGAGAGGGG + Intronic
1069726343 10:70582755-70582777 GTCCTGGGACTGCCTGGGCATGG + Intergenic
1071114494 10:82201347-82201369 GTTCTAATACTGCTTGAGAATGG + Intronic
1074085737 10:110207956-110207978 GTGTTGAAAATGTCTGAGAAGGG - Exonic
1075857036 10:125638254-125638276 AGGCTGAGGCTGCCTGAGGATGG - Intronic
1076579880 10:131500170-131500192 GTGTGGAGACTGCCTGAGATGGG - Intergenic
1077030118 11:461727-461749 CCGCTGGGACTGCCTAAGAAAGG - Intronic
1077440576 11:2566939-2566961 GTGCTGAGCTGGCCTGAGAAGGG + Intronic
1078955847 11:16194111-16194133 TTGTGGTGACTGCCTGAGAAAGG + Intronic
1079360185 11:19764193-19764215 GTGCTGAGAGTGGCTGAGAGTGG - Intronic
1084842113 11:71862670-71862692 GTGCTGAGAAGGCAAGAGAAAGG + Intergenic
1085456912 11:76670636-76670658 GTGCCGAGACTGCCCGGGAGAGG - Intronic
1085469528 11:76748384-76748406 GTGCTGGGACTCCCAGAGCAGGG - Intergenic
1087175926 11:95095378-95095400 GTGCTGAGACTGGATAAGACTGG + Intronic
1087626601 11:100603503-100603525 GGGTGGAGCCTGCCTGAGAAGGG + Intergenic
1088586867 11:111367146-111367168 GTGCGGAGAGTGCCGGGGAAAGG - Intronic
1090258288 11:125301194-125301216 CTGCTGGGACTGCCTAGGAAAGG + Intronic
1091251036 11:134144524-134144546 GAGCTGAGACTGCCTGAGTTGGG + Intronic
1093067414 12:14672819-14672841 GTGCTGTGACTGGGTGAGGAGGG - Intronic
1094296219 12:28908833-28908855 GTACTGAGAATGACTCAGAAAGG - Intergenic
1097033549 12:56106632-56106654 GTACTGAGCCTGTGTGAGAAAGG + Exonic
1100113102 12:91269599-91269621 GTGCTAAGACTGCCTCAGCCTGG + Intergenic
1102315477 12:111884007-111884029 GTGCAGAGACTGCCTATGGAGGG - Intronic
1105215044 13:18279256-18279278 GTGCAGAGACTGCCTGGGGGTGG - Intergenic
1106196144 13:27495708-27495730 GTGTGGAGATTGCCTGGGAAAGG + Intergenic
1111522165 13:89419531-89419553 GTGCTGATCCTGTCTGAGACAGG - Intergenic
1111532471 13:89556855-89556877 GTGCTGAGCCTGCCTGATGAAGG - Intergenic
1111922785 13:94430110-94430132 GTGCTGAGACTACAGCAGAATGG + Intergenic
1112035869 13:95496109-95496131 ATGCAGACACAGCCTGAGAAAGG - Intronic
1112436554 13:99394798-99394820 GTGCTGTCACTTCCTGAGATAGG - Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1116330428 14:43590232-43590254 GTGATCAGACTGCATGAAAACGG + Intergenic
1116621404 14:47208660-47208682 CTGCTGAGTCAGCCAGAGAATGG - Intronic
1117047550 14:51828342-51828364 GAGCTGTGCCTGCCTGAAAATGG + Intronic
1119444929 14:74655154-74655176 GTCCTGGGACAGCCTGGGAAAGG - Intronic
1119694903 14:76705423-76705445 GTGCTGAGACAGCAGGAGCAGGG - Intergenic
1121602444 14:95215892-95215914 ATGCTGAGTGTCCCTGAGAATGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1124229424 15:27930680-27930702 GGTCAGAGACTGCCTGAGGATGG + Intronic
1124355315 15:28991170-28991192 GTGCTGAGACAGGCAGAGGAGGG - Intronic
1124590471 15:31049147-31049169 GAGTTAATACTGCCTGAGAAAGG + Intronic
1125193808 15:37023655-37023677 GTGCTGAGACTGCCTGAGAAAGG + Intronic
1127641265 15:60917981-60918003 TTGCTGTTACTGGCTGAGAATGG - Intronic
1128865479 15:71111946-71111968 GCACTGAGATTGCCTGAGAGGGG - Intronic
1129612560 15:77072079-77072101 CTTCTGAGAGTGCCTGGGAAAGG - Intronic
1129886111 15:79038241-79038263 GTGCTGAAGCTGTCTGGGAATGG - Intronic
1129897166 15:79117081-79117103 GAGCTGGGACTCCCTGAGGAAGG + Intergenic
1131469405 15:92683377-92683399 GTGCTGAGATGGTCTAAGAAGGG - Intronic
1132623182 16:877838-877860 GTGCAGAGGTTGTCTGAGAAAGG + Intronic
1132912964 16:2325142-2325164 GTGATGAGAAAGCCTGAGAAGGG - Intronic
1132996735 16:2827390-2827412 GTGTTGAGTCTCCCTGAGCACGG + Intergenic
1133810893 16:9160319-9160341 GTCCTGAGACTCCCCGAGGACGG - Intergenic
1134151643 16:11810028-11810050 GGGGTGAGTCTGCCTGAGAATGG - Intergenic
1134382725 16:13743281-13743303 ATGCTGATACTCCTTGAGAATGG + Intergenic
1135122385 16:19777691-19777713 GTACTGAGTGCGCCTGAGAAAGG - Intronic
1135144650 16:19950651-19950673 GTGGGGAGAATGCCTGAGACAGG + Intergenic
1136101974 16:28003370-28003392 GGGCTGAGACAGCCAGAGAGAGG - Intronic
1137397862 16:48129296-48129318 GCACTGTGACTGCCAGAGAAGGG + Intronic
1137401289 16:48156161-48156183 GTGCTGTGACAGCCAGGGAAGGG - Intergenic
1138062611 16:53907695-53907717 GTGATTAGACTGATTGAGAAAGG - Intronic
1142897958 17:2994447-2994469 GTGAGGAGACAGCCAGAGAAGGG + Intronic
1143275052 17:5704108-5704130 GTGCTCAGACTGCATCAGAGGGG - Intergenic
1143314719 17:6023650-6023672 CTGCAGAGACTGGCTGTGAAGGG + Intronic
1144892438 17:18501616-18501638 GTCCTGAGAGTGCCTGAGTGGGG - Intergenic
1145018564 17:19413790-19413812 GTTCTGGGGCTGCCTTAGAAGGG + Intronic
1145139776 17:20442672-20442694 GTCCTGAGAGTGCCTGAGTGGGG + Intergenic
1145748431 17:27337785-27337807 GTCCAGAGTCTGCATGAGAAGGG + Intergenic
1145796084 17:27656006-27656028 GTCCTGAGAGTGCCTGAGTGGGG - Intergenic
1145810535 17:27761326-27761348 GTCCTGAGAGTGCCTGAGTGGGG - Intronic
1146259188 17:31410670-31410692 GGGCTGAGTCTGCCTGGGAAGGG + Intronic
1149431609 17:56598525-56598547 CTTCTGAGACTCCCTGGGAAAGG + Intergenic
1150352541 17:64457161-64457183 GTGCTGAGAAAGCCAGAGAGTGG - Intronic
1153722992 18:7925992-7926014 ATGCTGAGACTGCCATAGCATGG - Intronic
1156471009 18:37377251-37377273 CTGGTAAGACTGCCTGAGGACGG + Intronic
1156478311 18:37420404-37420426 GTGCTGAGAATGGCTGTGAACGG + Intronic
1157579608 18:48765681-48765703 GTGTTGAGTCTGGCTGGGAAGGG - Intronic
1158513685 18:58113618-58113640 GTGCAGAGACTGCCAGAAGAGGG + Intronic
1158995617 18:62915917-62915939 GTTCAGTGACTGGCTGAGAATGG - Intronic
1159060675 18:63510895-63510917 GGGCTGTGCCTGTCTGAGAAAGG + Intergenic
1160043806 18:75368904-75368926 ATCATTAGACTGCCTGAGAAAGG - Intergenic
1165364702 19:35358413-35358435 CAGCTGAGACTGCATGAGGAGGG + Intergenic
1166282224 19:41801698-41801720 GTGCTGAAACTGCCTCTGAGTGG + Intronic
1167707553 19:51090531-51090553 GTGGGGAGGCTGCCTGAGGAGGG + Intergenic
1167830475 19:52016938-52016960 GAGCTGAGACTTCCTAAGGAAGG + Exonic
926320055 2:11743413-11743435 GTGCTGTGGCTGGCTGAGCAGGG - Intronic
927809767 2:26174351-26174373 GTACTGTGTCTGCCTGTGAATGG + Intronic
930066596 2:47332510-47332532 GTGCTGAGACTGCTTTGGAATGG - Intergenic
934299276 2:91767481-91767503 GTGCAGAGACTGCCTGGGGGTGG + Intergenic
935840273 2:107101610-107101632 AGGCTGAGAATGCCTGAGAAGGG - Intergenic
936639252 2:114293630-114293652 GTGTTGAGAAAGCCTGAGAAGGG - Intergenic
943592659 2:189817697-189817719 GTGCTCAAACTACCTGGGAATGG - Intronic
943778262 2:191792092-191792114 GTCCTGAGACTGCCTAAGCAGGG + Intergenic
946430637 2:219625439-219625461 ATACTGAGACAGCCTGAGAAGGG - Intergenic
946934862 2:224709384-224709406 GAGCTGGAACAGCCTGAGAATGG - Intergenic
947021583 2:225683296-225683318 GTGCTGAGAGAGCCTGAGAGGGG + Intergenic
948157913 2:235799482-235799504 GCGCTTAGACTGCTTGCGAACGG - Exonic
948338642 2:237231338-237231360 CAGCTGAGACAGCCTGAGCAGGG - Intergenic
949036697 2:241818741-241818763 GGGCTGAGGCTGCCTGAGGTGGG - Intergenic
1169582428 20:7038742-7038764 GTTCTGCCACTTCCTGAGAATGG + Intergenic
1169781419 20:9314519-9314541 GTGGAGAGAATGCCAGAGAAGGG + Intronic
1170119509 20:12896209-12896231 GGGCTGACACTGGCAGAGAAAGG - Intergenic
1170622514 20:18007697-18007719 GTGCTGAGACTACCTGGAAGGGG - Intronic
1172578944 20:36031537-36031559 GTGCTGAGGCTGCTGGAGACAGG - Intergenic
1173733568 20:45344595-45344617 GTGCTGAGCCTGCCTGAATGAGG - Intronic
1174547417 20:51335952-51335974 GTGCTGAGGTTGCCTGGGCACGG + Intergenic
1179565178 21:42243107-42243129 ATGCTGAGGCTGCCTGACCATGG - Intronic
1179569200 21:42268087-42268109 GTGCAGAGACTGCCAGAGCCAGG - Intronic
1180975695 22:19846889-19846911 CTGCTGGGGCTGCCTGACAAAGG - Exonic
1183802388 22:40177815-40177837 GAGCTGAGACTGCCTTAAAGGGG - Intronic
1184506917 22:44909405-44909427 GTGCAGACACTGCCACAGAATGG + Intronic
1185325103 22:50221672-50221694 ATGCTGAGGCTGTCAGAGAAGGG + Exonic
1185336743 22:50274309-50274331 AGGCTGGGGCTGCCTGAGAATGG + Intergenic
1185414204 22:50700894-50700916 CTGCGGAGGCTGCCTGCGAAGGG + Intergenic
950154571 3:10711980-10712002 GTGCTGACATAGCCTGGGAAAGG + Intergenic
950214094 3:11145721-11145743 GTACTGTTACTGACTGAGAAGGG - Intronic
950648691 3:14393724-14393746 GAGCTGGGGCAGCCTGAGAACGG + Intergenic
951660668 3:25061078-25061100 GTCCTGAGTTTTCCTGAGAAAGG + Intergenic
955986217 3:64576631-64576653 GAGCTGAGAGCGCCTGAGATTGG + Intronic
956877600 3:73479123-73479145 GAGCTTAGACTGCTTGAAAAAGG + Intronic
957851247 3:85810168-85810190 GAGCTATGACTGGCTGAGAAGGG + Intronic
962359887 3:134730014-134730036 TTGCTGAATGTGCCTGAGAAGGG - Intronic
963547633 3:146680855-146680877 ATGCTAATACTGCTTGAGAATGG + Intergenic
964450762 3:156810577-156810599 GTACTGAGCCTGTGTGAGAAAGG - Intergenic
966709206 3:182952719-182952741 GTGTTGATAATCCCTGAGAAAGG + Intronic
966939940 3:184739583-184739605 GGGTTGAGACTACCTGAGCAAGG - Intergenic
968495361 4:912310-912332 ATGCTGGGACAGCCTGAGAAGGG + Intronic
969226802 4:5803920-5803942 GTGATGAGGCTGCCTGAGACAGG - Intronic
969783219 4:9428701-9428723 GTGCTGAGAAGGCAAGAGAAAGG + Intergenic
973209149 4:47596160-47596182 GTGCAGAAAATGCCTGAAAAAGG - Intronic
982524520 4:156461039-156461061 GTGCTGAGAATGCCAGTGTAAGG + Intergenic
982791225 4:159593799-159593821 ATGCTGTGGTTGCCTGAGAAAGG - Intergenic
984176212 4:176420630-176420652 GTGCTGATACTACCAGAAAAGGG - Intergenic
987049895 5:14140487-14140509 TTTCTGAGACTGGCTGGGAAGGG + Intergenic
989300689 5:39888966-39888988 CTGCTGAGACTGCCACAGTATGG - Intergenic
990835550 5:60015234-60015256 GTGATGAGACTTTCTGAAAAGGG + Intronic
992688921 5:79224326-79224348 GTGCTGAGTCTGCCTCTGGATGG + Intronic
995555524 5:113324169-113324191 GTTCAGAGGCTGCCTCAGAAAGG - Intronic
995610144 5:113900853-113900875 GGGCTGTGACTGCATGAGACAGG + Intergenic
996778766 5:127160644-127160666 GGGTGGAGCCTGCCTGAGAAGGG - Intergenic
998705448 5:144754137-144754159 ACGCTGTGACTGCCTGAGAAGGG + Intergenic
998898071 5:146821443-146821465 GTGCTGTGACAACCAGAGAAGGG - Intronic
999908384 5:156168913-156168935 ATGCAGAGAGTGCCTGGGAAGGG - Intronic
999973891 5:156891856-156891878 GTCCTGGGAGTGGCTGAGAAGGG + Intergenic
1001525232 5:172424052-172424074 GGGGGGAGCCTGCCTGAGAAAGG + Intronic
1001824970 5:174737176-174737198 GTGCTGAGAATGCTTGATGATGG + Intergenic
1002527981 5:179825676-179825698 GTGCTGGGCCTGCCTCAGAGCGG + Intronic
1003045928 6:2732668-2732690 GAGCTGAGAGAGCCTGAGGAGGG + Intronic
1004176680 6:13346200-13346222 ATGCAGAGACGGCCTGAGATAGG - Intergenic
1005896557 6:30184143-30184165 GTGATGACTCTCCCTGAGAAGGG - Intergenic
1006186056 6:32182336-32182358 GTGCTGATCCTCCCTGAGATAGG - Exonic
1006822906 6:36912694-36912716 GAGTTGAGACTGGCTGAGAAAGG + Intronic
1006870140 6:37243861-37243883 GTGCTGAGTCTGCCTCTGGATGG + Intronic
1007402066 6:41608545-41608567 CTGCTGAGTCTGCTGGAGAAGGG - Intergenic
1008295730 6:49773972-49773994 TTTCTGAGACTTCCTGAGAAAGG - Intergenic
1009683437 6:66926819-66926841 AGGCTGAGATTGCCTCAGAATGG + Intergenic
1010284117 6:74055269-74055291 GTGATGTGTCTGCCTGAGAGAGG - Intergenic
1010812374 6:80315017-80315039 GTGTGGAGGCTGCCTGAGAGGGG - Intronic
1011137873 6:84118662-84118684 GGGTAGAGCCTGCCTGAGAAGGG - Intergenic
1016423857 6:143913403-143913425 GGGCGGAGCCTGCCTGAGACAGG - Intronic
1019364003 7:622008-622030 GTGAAGAGACTGGCTGAGATCGG - Intronic
1021019476 7:15578677-15578699 CTGCTGAGATTGGCTGAGACTGG + Intergenic
1021263926 7:18495724-18495746 GAGCTGAGAGAGACTGAGAAAGG + Intronic
1021545187 7:21805035-21805057 GTGATGTGACTGCCTGGGAAAGG - Intronic
1023158469 7:37275104-37275126 GTGCTCTGTCTGCCTGACAAAGG + Intronic
1024700933 7:51903545-51903567 GAGCAGAGCCTGCCTGTGAATGG + Intergenic
1030195941 7:106853688-106853710 GTGGTGACACTGTTTGAGAAGGG - Intergenic
1031861160 7:126981849-126981871 TTTCTCAGATTGCCTGAGAAAGG - Intronic
1033219151 7:139516617-139516639 GGGCTCACCCTGCCTGAGAAGGG + Intergenic
1033583724 7:142759147-142759169 GAGCTCAGAGTTCCTGAGAAGGG + Intronic
1035661698 8:1352878-1352900 GGGCTGAGAGAGCCTGAGAATGG + Intergenic
1035752411 8:2005543-2005565 TTGCTGAGACTGCCTGGCAACGG + Exonic
1035960749 8:4134760-4134782 GTGTTGAGAATGGCTCAGAAGGG - Intronic
1036835831 8:12065350-12065372 GTGCTGAGAAGGCAAGAGAAAGG - Intronic
1036857674 8:12311919-12311941 GTGCTGAGAAGGCAAGAGAAAGG - Intergenic
1038385838 8:27143979-27144001 GGGTTGAGACGGCATGAGAAGGG + Intergenic
1038952104 8:32426624-32426646 GTGTTGAGACTGGGAGAGAAGGG - Intronic
1039547626 8:38421249-38421271 CTGCTGCGGCTGCCTGAGACAGG + Intronic
1043909106 8:85839822-85839844 CTGCTGAGACTACCTGAGACTGG - Intergenic
1044846458 8:96386617-96386639 GTGCTGTGGCTGCCTAAGCAGGG + Intergenic
1045307940 8:100974866-100974888 GTGCAGAGACTGCCTGTTACAGG + Intergenic
1046714430 8:117552076-117552098 GGGCTGTAACTACCTGAGAAAGG - Intergenic
1048259794 8:132936007-132936029 GTGCTGAGTCTGCCAAAGGATGG - Intronic
1049009213 8:139876031-139876053 GAGCTCAGACTGCCTGGAAAAGG - Intronic
1049923879 9:390289-390311 GTGCTGAGATCACCTGAGACTGG - Intronic
1051380247 9:16450773-16450795 GTGCTTAGACTCCCTGGGCAAGG - Intronic
1051640939 9:19224060-19224082 GTGCTAACACTCCCTGCGAAGGG + Intergenic
1053016636 9:34665726-34665748 GTCCTGAGAATGACGGAGAAGGG - Exonic
1056491174 9:87108737-87108759 GTGATGTGACAGCCTGGGAAGGG - Intergenic
1056766898 9:89449691-89449713 GTACTGAGCCTGTGTGAGAAAGG + Intronic
1057015134 9:91644665-91644687 GAGGTGAGTCTGCCTGAGATGGG - Intronic
1057184909 9:93052002-93052024 GTGATGAGCCGGCCTGGGAATGG + Intergenic
1060466811 9:123913946-123913968 GTGCAGAAAGTGCCTGAGACTGG - Intronic
1060485160 9:124041948-124041970 GAGCTGAGCCTGCCTGAGGAGGG + Intergenic
1062726507 9:138077118-138077140 GTGCTGGGCCTGACTGATAAGGG - Intronic
1186142963 X:6596435-6596457 GTGAAGAGACTACCTGAGACTGG + Intergenic
1188901204 X:35734471-35734493 GTGTGGAGCCTGCCTGAGACTGG - Intergenic
1189224504 X:39401477-39401499 GTGCTGAGACTTCCTCTCAAAGG - Intergenic
1190586227 X:51945437-51945459 GAGAGGAGACTGCCTGAGACAGG - Intergenic
1194391870 X:93329003-93329025 CTGGAGAGTCTGCCTGAGAATGG - Intergenic
1196741941 X:119032620-119032642 GTGGGGAGACTGGCTGGGAAGGG + Intergenic
1198113253 X:133521496-133521518 GAGCTGAGACTTCCAGAGAAGGG + Intergenic
1199973579 X:152878033-152878055 GGCCTGGGACTGCCTGAGGATGG + Intergenic
1202151625 Y:21848916-21848938 GTCCAGCCACTGCCTGAGAAAGG + Intergenic