ID: 1125195023

View in Genome Browser
Species Human (GRCh38)
Location 15:37035897-37035919
Sequence AGTAGCACATTGAAAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125195023_1125195024 8 Left 1125195023 15:37035897-37035919 CCTTCAGCTTTCAATGTGCTACT 0: 1
1: 0
2: 1
3: 22
4: 201
Right 1125195024 15:37035928-37035950 AAGTATTAGCCTAAATAGAATGG 0: 1
1: 0
2: 1
3: 21
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125195023 Original CRISPR AGTAGCACATTGAAAGCTGA AGG (reversed) Intronic
902663516 1:17921711-17921733 AGCAGCCCATTGGAGGCTGATGG + Intergenic
904581136 1:31545077-31545099 AGTAACACATTGAAGCCTGAAGG - Intergenic
905778407 1:40686226-40686248 AGTGGCACATTGTAAGCTGTGGG - Intergenic
906177833 1:43791070-43791092 AATAGGACATTCAAAGCAGAGGG - Intronic
908783585 1:67713704-67713726 AGAAAGACATTGAAAGTTGAAGG - Intronic
909971123 1:81991013-81991035 GGTAGCACATCTGAAGCTGATGG - Exonic
910283094 1:85523170-85523192 AGTGGAAAATTCAAAGCTGAGGG + Intronic
910503688 1:87924800-87924822 AGTATCATATTAAAATCTGAAGG - Intergenic
910504350 1:87932731-87932753 AGTTAAACATTGAGAGCTGATGG + Intergenic
910616626 1:89205445-89205467 AGTTGCACAGTGAAAGCTGTTGG - Intergenic
911256271 1:95637090-95637112 AGGAGCACTTTGAAAGATGCAGG - Intergenic
912206103 1:107510961-107510983 AGGTGCACAGTGCAAGCTGATGG - Intergenic
912907039 1:113718398-113718420 AGGAGCACAGTGCAAGCTGTTGG + Intronic
913164196 1:116169934-116169956 AGTGGCACAATGATAGCTCATGG + Intergenic
913353517 1:117890640-117890662 AGTAGCACATGGTTAGATGAAGG - Intronic
914489735 1:148143788-148143810 AGGAGCAGATTGAAAGGTGGTGG + Intronic
914728756 1:150351831-150351853 AGAAGAAAATTGAAAGATGAGGG - Intronic
918259714 1:182784607-182784629 AGAAGAACATTTAAAACTGAGGG + Intergenic
918591879 1:186249475-186249497 AGGAGCACAGTGCAAGCTGCTGG + Intergenic
920016432 1:202913704-202913726 AGCAACAAATTGAAATCTGATGG + Intronic
921247266 1:213257722-213257744 GGTGGCACATTCAAAACTGATGG + Intronic
921834495 1:219763706-219763728 AGTGGCACAATCATAGCTGACGG - Intronic
923036651 1:230289159-230289181 AGTAGGACTTAGAAAGCTTAAGG + Intergenic
1068148448 10:53100777-53100799 AGGTGCACTTAGAAAGCTGATGG - Intergenic
1068777651 10:60885565-60885587 TGTAGCACATGGTAACCTGAAGG + Intronic
1075088584 10:119430290-119430312 AGTGGCACATTGAGAGCAGCTGG - Intronic
1075177317 10:120177606-120177628 AATATCACATTGACAGCTGGAGG - Intergenic
1075402565 10:122171668-122171690 TTTAGCACATTGAAAGTTAAAGG - Intronic
1075700573 10:124467064-124467086 AGTAGCACATTCATAGCTCACGG - Intronic
1076026251 10:127116412-127116434 AGCAGCCCTTTGAAATCTGAGGG + Intronic
1076051388 10:127336360-127336382 AGTAGCATGAGGAAAGCTGAAGG - Intronic
1076091839 10:127693333-127693355 AGCAGAACATTCAAGGCTGATGG + Intergenic
1078505583 11:11940507-11940529 AGTAAAACCCTGAAAGCTGAAGG + Exonic
1078582546 11:12549924-12549946 AGTACCAGATTGTAAGCTCAAGG - Intergenic
1080115564 11:28618056-28618078 AGTAGCACAATGCAACCTTAGGG - Intergenic
1081016679 11:37891185-37891207 AGGAGCATAGTGAAAGCTGTTGG + Intergenic
1081365692 11:42232303-42232325 ACTAGAACATAGAAAGCAGAAGG - Intergenic
1085907261 11:80778649-80778671 AGTAGCACAGTGAAAACCGCAGG + Intergenic
1086998571 11:93389307-93389329 AGTAGCACAGTGATAACTTAAGG - Intronic
1087052049 11:93896192-93896214 AGGTGCACTTAGAAAGCTGAGGG - Intergenic
1087104992 11:94399925-94399947 ATTTGCACATTGGCAGCTGATGG - Intronic
1087621192 11:100544438-100544460 AGAATGACATTGCAAGCTGAGGG + Intergenic
1091389700 12:118574-118596 AGGAGCATTTTGAAGGCTGATGG - Intronic
1092798594 12:12139865-12139887 AGTAGCCCAGAGAAAGCTAAAGG + Intronic
1093527885 12:20124228-20124250 AGAAACACACTGAAGGCTGATGG + Intergenic
1093670375 12:21867321-21867343 AGTACCACATTGAATGGTGGAGG - Intronic
1093874949 12:24339365-24339387 AGTGGCACATTCTAAGCAGAGGG + Intergenic
1094097630 12:26725507-26725529 AGCAACACATTGAAAGTAGAAGG - Intronic
1096088975 12:48885650-48885672 GATGGCACAGTGAAAGCTGAGGG + Intergenic
1096753989 12:53783573-53783595 AGCTGCAGATTTAAAGCTGATGG - Intergenic
1097640267 12:62172726-62172748 AATTGCACACTGAAAGCTAAAGG + Intronic
1100056307 12:90515314-90515336 AGTAGCACATTTAAGGAGGATGG - Intergenic
1100231501 12:92612906-92612928 AGCAGCACACAGGAAGCTGATGG - Intergenic
1100625944 12:96332328-96332350 AGTAGCATAATGCTAGCTGAAGG - Intronic
1101286119 12:103314330-103314352 AGTTGCCCAGTGAAAGGTGATGG + Intronic
1106012155 13:25835326-25835348 TGTAGCACATTGAAATCCCAGGG + Intronic
1108419520 13:50234147-50234169 AGGTGCACAGTGCAAGCTGACGG - Intronic
1109109097 13:58293022-58293044 AGATGCACATTGCAAGCTGGCGG - Intergenic
1110022351 13:70490941-70490963 AGATGCACAGTGAAAGCTGTTGG - Intergenic
1111178126 13:84625218-84625240 AGTTACACACTGAAAGTTGAGGG - Intergenic
1111318099 13:86586832-86586854 AGGTGCACAATGAAAGCTGTTGG - Intergenic
1113387989 13:109868917-109868939 ATTACCACATTTAAATCTGATGG - Intergenic
1113501825 13:110781936-110781958 AGGTGCACATTGCAAGCTGTTGG + Intergenic
1114858534 14:26484905-26484927 AGTATCATATTAGAAGCTGAAGG + Intronic
1115012450 14:28565748-28565770 AGTAGAACATTTAAAGATGCAGG + Intergenic
1115629287 14:35227570-35227592 AGAAGAACATTAAAAGCTAAAGG - Intronic
1116477425 14:45357474-45357496 AGTGCCACACTGGAAGCTGAAGG - Intergenic
1116866193 14:50033608-50033630 AGTGGCACATTCACAGCTCATGG - Intergenic
1119150889 14:72358353-72358375 AGTTGCACAGTGCAAGCTGGGGG - Intronic
1124788256 15:32701833-32701855 TGGAGCACTTTGAAAGTTGATGG - Intergenic
1125195023 15:37035897-37035919 AGTAGCACATTGAAAGCTGAAGG - Intronic
1125456063 15:39860078-39860100 ATTATCACCTTGAAATCTGAGGG - Intronic
1125710314 15:41779979-41780001 AGAATCACTTTGAAGGCTGAGGG - Intronic
1134423070 16:14112389-14112411 GGTAGGAAATTCAAAGCTGAGGG + Intronic
1140586896 16:76303313-76303335 AGTATCACACTTAAAGATGAAGG - Intronic
1141004856 16:80342570-80342592 TGTAGCTATTTGAAAGCTGAGGG + Intergenic
1141467557 16:84216451-84216473 AGGTGCACCTAGAAAGCTGAGGG + Intergenic
1148100916 17:45090728-45090750 AGAAACCCATTGAAAGCTCAGGG + Intronic
1150012348 17:61516590-61516612 AGTAGCAAATTAAAAGATGAGGG + Intergenic
1151042175 17:70875035-70875057 TGTAGCAAATAGAAAGCTGAGGG + Intergenic
1153689024 18:7573248-7573270 AGAAACACATGGAAAGTTGAAGG + Intronic
1155725101 18:29071877-29071899 AGTAGCACATTCAAAACTCTGGG + Intergenic
1156978454 18:43255300-43255322 AGAAGCAAATTGAAAGTTGAGGG - Intergenic
1159873318 18:73783122-73783144 TGTACCACATTGAAACCTTAAGG + Intergenic
1163231155 19:16003148-16003170 AGCAGCACAGTGGAACCTGAGGG - Intergenic
1163349455 19:16766463-16766485 AGTAGCAAATTGCAGTCTGAGGG - Intronic
1164757865 19:30703597-30703619 GGTAGCACCATGAAAGCTTAAGG - Intronic
1166186659 19:41143944-41143966 AGTATCACATTGAATCCTCATGG + Intergenic
925805590 2:7644904-7644926 AGGAGCACAGTGCAAGCTGTTGG + Intergenic
926342647 2:11917151-11917173 AGTAGTACATTGCAAAATGAAGG + Intergenic
927340275 2:21975739-21975761 ACTAGCACACTCAAAGCTCAAGG + Intergenic
933244157 2:79956405-79956427 AACAGTATATTGAAAGCTGATGG + Intronic
934742031 2:96731163-96731185 AGTAGCACTGAGAATGCTGATGG - Intronic
939290926 2:140193964-140193986 ATTAGCTCATTGAAAGCTCTAGG + Intergenic
939480714 2:142743878-142743900 AGTAGCACAATCATAGCTCATGG + Intergenic
939668780 2:144983252-144983274 AGTAGCAAATTAAAAGCAGCTGG - Intergenic
940249548 2:151659549-151659571 ACTAGCACTTTGGAAGGTGAAGG - Intronic
940568888 2:155405097-155405119 AGTAGCTCCTTGGAAACTGAGGG + Intergenic
942979966 2:182068990-182069012 CGTCGCACATTGAAAATTGAAGG + Intronic
943477694 2:188379287-188379309 ATTACCATACTGAAAGCTGAGGG + Intronic
944031585 2:195240825-195240847 AGTATAACATGTAAAGCTGATGG + Intergenic
947553785 2:231069416-231069438 ATTAGCACACTGAAAGCTACAGG - Intronic
1169332425 20:4726784-4726806 AGAAGAACACTGATAGCTGAGGG - Exonic
1169402687 20:5296504-5296526 AGTAAAACATTGAAGGCAGATGG + Intergenic
1169656254 20:7927084-7927106 AGTAGCTCCATGAAAGATGAAGG + Intronic
1171515627 20:25730702-25730724 AGTGGGAAATTGAAAGGTGAAGG - Intergenic
1171724707 20:28605455-28605477 AATAGCACATTATAAGTTGAGGG + Intergenic
1171753358 20:29077593-29077615 AATAGCACATTGTAAGTTGAGGG - Intergenic
1171788897 20:29499967-29499989 AATAGCACATTGTAAGTTGAGGG + Intergenic
1171858633 20:30374532-30374554 AATAGCACATTGTAAGTTGAGGG - Intergenic
1172119579 20:32589953-32589975 AGAAGCACAATAAATGCTGATGG - Intronic
1177281737 21:18989908-18989930 AGTAGTATATTGAAACCAGAGGG - Intergenic
1177495421 21:21884014-21884036 AGAAACACATTGAAAGCTGTGGG - Intergenic
1177866647 21:26520280-26520302 AGTTGAACATTGAAAACTCATGG - Intronic
1178787460 21:35667097-35667119 AGTAGGACCTTAAATGCTGAAGG + Intronic
1180298257 22:10964145-10964167 AATAGCACATTGTAAGTTGAGGG + Intergenic
1180410154 22:12599655-12599677 AATAGCACATTGTAAGTTGAGGG - Intergenic
1182815220 22:33156254-33156276 AGAAGCACAGTGCAAGCTGTTGG - Intergenic
1182838361 22:33363124-33363146 AGTAGCAGAGTGTGAGCTGAGGG + Intronic
1183561921 22:38581798-38581820 AGTAGCACAATCACAGCTCATGG + Intronic
1184951816 22:47848497-47848519 AGTGGCACATTGTGAACTGATGG - Intergenic
949109856 3:246434-246456 CCTAGCACAATGAAAACTGACGG - Intronic
952306604 3:32152495-32152517 AGTGGCACCTTGAATGCTGCCGG + Intronic
952641017 3:35596166-35596188 AGTAGCAAAATAAAAGCTGGAGG - Intergenic
955407215 3:58633139-58633161 AGGAGCACATTGAAATGGGAAGG - Intergenic
957034570 3:75281859-75281881 AGTTTCACCTTGAAAGCTGAAGG - Intergenic
958915444 3:100045450-100045472 AGCAGCACAATGAAAGCTAATGG - Intronic
959297471 3:104555341-104555363 AGTAGCACAGTGATAGGAGAAGG - Intergenic
960099915 3:113730348-113730370 AATAGAAAATTGCAAGCTGATGG - Intronic
960518182 3:118624918-118624940 AGTAGCACAGTCACAGCTCATGG - Intergenic
961078437 3:124003444-124003466 AGTTTCACCTTGAAAGCTGAAGG - Intergenic
961305035 3:125953001-125953023 AGTTTCACCTTGAAAGCTGAAGG + Intergenic
963119405 3:141763551-141763573 AGTAGCCCAGTGGAAGCTGCAGG + Intergenic
963873029 3:150440086-150440108 AGAAGAAAATTGAAAGCTTAGGG + Intronic
964474047 3:157082973-157082995 ACTTGCACTTTAAAAGCTGAGGG + Intergenic
964601643 3:158507602-158507624 AGCAGCATCTTGAAAGTTGATGG + Intronic
965031265 3:163371140-163371162 AATAGTACATGGAAAGATGATGG + Intergenic
965198579 3:165629104-165629126 AGGTGCACAGTGCAAGCTGACGG + Intergenic
965313875 3:167166297-167166319 AGTTTCACATTAAAACCTGATGG + Intergenic
967153259 3:186668886-186668908 AGTAGCACATGGAAACCTAGCGG - Intronic
967277821 3:187793965-187793987 AACATCACATTTAAAGCTGAGGG + Intergenic
967366794 3:188696101-188696123 AAAAGCACATAGAAAGGTGAAGG + Intronic
967509383 3:190291996-190292018 AGGTGCACATTGCAAGCTGTTGG + Intergenic
970611039 4:17725564-17725586 ATTAGCACATTTGAAGGTGAGGG + Intronic
971900271 4:32649881-32649903 AGGTGCACAATGAAAGCTGTTGG + Intergenic
974100271 4:57408675-57408697 AGTAACACATTGAGAGCAAAGGG - Intergenic
976255564 4:83097067-83097089 AGTAGCAAATAAACAGCTGAAGG - Intronic
977476394 4:97515528-97515550 AGTAGTAAATTGTAAGTTGAGGG + Intronic
978261254 4:106762634-106762656 AAATGCATATTGAAAGCTGAAGG - Intergenic
981173436 4:141651866-141651888 AGTGGCAGAGTGAAAGATGAAGG - Intronic
982174039 4:152688713-152688735 AGAAGGAGATTGAAAGCTGAGGG + Intronic
983048115 4:163011101-163011123 AGGGGCACAGTGAAAGCTGTTGG + Intergenic
983871514 4:172829440-172829462 AGCAGCACAATGAAAGAAGAAGG + Intronic
984865578 4:184277566-184277588 AGGAGCACAGTGCAAGCTGTCGG - Intergenic
984915253 4:184717883-184717905 AGAAGGACATTTAAAGCAGATGG + Intronic
985436779 4:189938245-189938267 AATAGCACACTGTAAGTTGAGGG - Intergenic
986533239 5:8760744-8760766 AGGTGCACAATGCAAGCTGATGG - Intergenic
987845262 5:23275841-23275863 AGTAGAACAGTGAAAGTTGAAGG + Intergenic
989532606 5:42525143-42525165 AGCAGCACAGTGCAAGCTGTTGG - Intronic
990266732 5:54084664-54084686 ATTAGTGCACTGAAAGCTGAGGG + Intronic
990501747 5:56403526-56403548 AGTAGCGCAGTGAGAGCAGATGG + Intergenic
990920468 5:60960489-60960511 AGTAGTACTTTGAAAAGTGAGGG - Intronic
991186605 5:63815792-63815814 AGGTGCACAGTGAAAGCTGTTGG - Intergenic
991514785 5:67423205-67423227 ACTGGTACATTGAAAACTGAAGG + Intergenic
993227568 5:85186590-85186612 AGAAGCACATGGAAAGATGCTGG + Intergenic
996281326 5:121732436-121732458 ATTAGCACATTGGTAGCAGAGGG + Intergenic
996887729 5:128378238-128378260 AGTAACACAATGAAAACTGCTGG + Intronic
998503520 5:142653672-142653694 GGCAGCACAATGAGAGCTGAGGG - Intronic
1000230341 5:159310113-159310135 AGTGGCACAATCAAAGCTCACGG - Intergenic
1004166370 6:13260315-13260337 AGTAGCACATTCACAGTTTAGGG - Intronic
1005466404 6:26119997-26120019 GGTAGCACATTTAAAGCACAAGG + Intronic
1009250718 6:61294252-61294274 TGGAGCACATTGAAACCTGTTGG - Intergenic
1010186093 6:73144849-73144871 AGCAGTACATTGATATCTGAAGG + Intronic
1011425028 6:87218595-87218617 GGTAGCTCATGAAAAGCTGATGG + Exonic
1012212837 6:96544513-96544535 AGTAGAACATTAATAGCTGCAGG - Intronic
1013039097 6:106416109-106416131 AGGAGAACTTTGAAAGCTGTGGG - Intergenic
1013127010 6:107193713-107193735 ATGATCACATTGAGAGCTGAAGG - Intronic
1013681557 6:112529781-112529803 ATTTGCACATGGAAATCTGAAGG - Intergenic
1014017783 6:116553479-116553501 AGCAGCACATAGAAAGATGGAGG + Intronic
1014496726 6:122133854-122133876 AGTAGCAAATTGTATGCTAAAGG - Intergenic
1015079547 6:129206892-129206914 TGAGGCACATCGAAAGCTGACGG + Intronic
1015955480 6:138593758-138593780 AGCAACACAAAGAAAGCTGAGGG + Intronic
1015956173 6:138600289-138600311 AGTAGCACAATGATGGCTCATGG + Intronic
1016885124 6:148951751-148951773 ATTAGCACAGTGAAGGCAGAGGG - Intronic
1016987135 6:149904141-149904163 AGTAGCTCACTGAGAGATGAGGG + Intergenic
1020902302 7:14020203-14020225 AGAAGCAGATTTAAAGATGAAGG - Intergenic
1024705094 7:51948302-51948324 GGAAGCACACTGAAAGCTCAAGG + Intergenic
1026876915 7:73884695-73884717 AGAGGCCCAGTGAAAGCTGATGG - Intergenic
1027766168 7:82345286-82345308 AGTAGCATATTGAAATGTAAAGG + Intronic
1028829857 7:95315321-95315343 ATTAGCACATTCACAGATGAAGG - Exonic
1029543058 7:101195979-101196001 AGGAGCACAAGGAAAGCTGTGGG - Exonic
1030470956 7:109961853-109961875 AGTAGCACAGTGACAGATAAAGG + Intergenic
1031790096 7:126092181-126092203 AGGTGCACAGTGAAAGCTGTTGG + Intergenic
1033581495 7:142741130-142741152 AGTGGCTCCTGGAAAGCTGAGGG + Intergenic
1034750005 7:153559815-153559837 AGATGCACAGTGAAAGCTGTTGG + Intergenic
1040131180 8:43798496-43798518 GGGAGCACATTGAAAGTTGTGGG + Intergenic
1041351349 8:56950894-56950916 AGGTGCACAGTGAAAGCTGTCGG + Intergenic
1042723337 8:71846868-71846890 AATAGCACTTTGAAAGTGGAAGG - Intronic
1043680763 8:83022215-83022237 AGGTGCACAGTGAAAGCTGTTGG + Intergenic
1045416571 8:101973517-101973539 AGTAGCACATAGATAGTTTAGGG - Intronic
1047373598 8:124276148-124276170 AGTGGCACAATCACAGCTGACGG + Intergenic
1047870512 8:129077202-129077224 AGTACCACATTCAAACGTGAGGG + Intergenic
1050271918 9:3955274-3955296 AGTTTCACATTGAAAGCTGAAGG + Intronic
1052230075 9:26139856-26139878 AGTAGAGTCTTGAAAGCTGAGGG + Intergenic
1052900203 9:33787063-33787085 AGTGGCTCCTGGAAAGCTGAGGG + Intronic
1053724905 9:40989722-40989744 AATAGCACATTGTAAGTTGAGGG - Intergenic
1054341063 9:63862279-63862301 AATAGCACGTTGTAAGTTGAGGG + Intergenic
1055033357 9:71792720-71792742 AGGAGGACAGTGAAGGCTGAGGG + Intronic
1058304505 9:103421652-103421674 AGAAACACATTAAATGCTGAAGG - Intergenic
1061869235 9:133511383-133511405 AGCAGCACATGGAAAGTTGGAGG - Intergenic
1061992069 9:134164781-134164803 AGTAGCCAATTAGAAGCTGAGGG + Intergenic
1203449910 Un_GL000219v1:102268-102290 AATAGCACATTGTAAGTTGAGGG + Intergenic
1185865562 X:3620760-3620782 AATAGCACAGTGATAACTGAAGG + Intronic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1187663168 X:21573296-21573318 AGGAGCACAGTGCAAGCTGTTGG + Intronic
1188753777 X:33935882-33935904 AGGAGCACAATGCAAGCTGTCGG + Intergenic
1189888069 X:45569997-45570019 AGAACTACATTGAAAGCTGTAGG + Intergenic
1193188991 X:78547093-78547115 AGCAGCACATTAAAATTTGAGGG - Intergenic
1193562422 X:83034818-83034840 AGTAGCACAATCATGGCTGAAGG - Intergenic
1194253941 X:91613481-91613503 AGGAGCACAATGAAAGCTGTAGG + Intergenic
1196652223 X:118179670-118179692 AGTAGAGAGTTGAAAGCTGAAGG + Intergenic
1197674503 X:129314914-129314936 AGTAGCAGATTTACAGATGAAGG - Intergenic
1200572726 Y:4853058-4853080 AGGCGCACAATGAAAGCTGTAGG + Intergenic
1200798139 Y:7360715-7360737 ATTAGAACAGTGATAGCTGAAGG - Intergenic
1201484974 Y:14484428-14484450 AGTCACACATTGAAGGATGAAGG + Intergenic