ID: 1125195750

View in Genome Browser
Species Human (GRCh38)
Location 15:37044103-37044125
Sequence TCTTATCTGTAGAATGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 775
Summary {0: 1, 1: 3, 2: 21, 3: 134, 4: 616}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125195750_1125195752 15 Left 1125195750 15:37044103-37044125 CCATCTCCATTCTACAGATAAGA 0: 1
1: 3
2: 21
3: 134
4: 616
Right 1125195752 15:37044141-37044163 GAAATTAGATGACTTGTCAAAGG 0: 1
1: 0
2: 9
3: 76
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125195750 Original CRISPR TCTTATCTGTAGAATGGAGA TGG (reversed) Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
902306103 1:15540579-15540601 TCTTATAGGTAAAATAGAGATGG + Intronic
903003603 1:20283847-20283869 TCTTATCTTTAGAGTGGAGATGG - Intergenic
903177178 1:21588082-21588104 TCCTATCTGTAAAATGGGGCCGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903353386 1:22731473-22731495 CCTTATCTGTCAAATGGAGAGGG + Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903927613 1:26841821-26841843 CTTTATCTGTAAAATAGAGATGG - Intronic
904223755 1:28996589-28996611 TGTGATGTGTAGGATGGAGATGG + Intronic
904890992 1:33779389-33779411 TGTCATCTGTAAAATGGAAATGG + Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905582060 1:39089826-39089848 CCTTATCTATAAAAGGGAGATGG + Intronic
905809086 1:40898952-40898974 GGTTTTCTGTAGGATGGAGAAGG - Intergenic
906027455 1:42685635-42685657 TGTTTTCTGTATAAAGGAGAGGG + Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906327802 1:44858913-44858935 TCTTTTATGTGGAATGGAGTTGG - Intronic
906369949 1:45245045-45245067 GCTCATCTTTAGAAGGGAGAGGG - Intronic
906441310 1:45848086-45848108 TCTTATCTATAGAATGTATAGGG + Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
907457744 1:54586216-54586238 TCTCATCTGCAGAATGGATGGGG + Intronic
907504622 1:54908922-54908944 GCTTATCTGTAATATGGAGCTGG + Intergenic
908057789 1:60309359-60309381 GCTTATCTTCAGAATAGAGATGG + Intergenic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908385497 1:63637409-63637431 TGTTTTCTGTAGAGGGGAGATGG + Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
909225904 1:73022523-73022545 TCTCATCTGTAAACTGAAGATGG - Intergenic
909391852 1:75129136-75129158 TCTCATTTGTAAAATGAAGATGG - Intronic
909873123 1:80768977-80768999 TTTTATTTGTATCATGGAGAAGG + Intergenic
910305736 1:85761195-85761217 TCTTATTTATAAAATGGAGATGG - Intronic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911472924 1:98340341-98340363 TGTTACCAGAAGAATGGAGAAGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911967556 1:104386878-104386900 GCTTATCTGTAATATGGAGCTGG - Intergenic
912056535 1:105605929-105605951 TCTTACCTGAAGAGTGGAGGTGG + Intergenic
912181465 1:107223871-107223893 GGTTATCCTTAGAATGGAGAAGG + Intronic
913539664 1:119806574-119806596 TCTTCTCTGTACAATGGAAATGG - Intronic
915147804 1:153805717-153805739 TCTTATCTGTGAAGTGAAGAGGG - Exonic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916792828 1:168138342-168138364 TCCTATCTGTAGAGTTGAAAAGG + Intergenic
918073510 1:181151447-181151469 TCTTATCTGTGAAATGGGAATGG + Intergenic
918723721 1:187890093-187890115 TATTATCTGTAGAATTTTGAAGG + Intergenic
919354952 1:196510318-196510340 CCTAATCTGTATAATGGAGGTGG - Intronic
919369883 1:196709711-196709733 TTTTATCTATAGAAAGGAAAAGG - Intronic
919382454 1:196875735-196875757 TTTTATCTGTAGAAAAGAAAAGG - Intronic
920007410 1:202843549-202843571 TATTATATGGAGAATAGAGATGG + Intergenic
920101513 1:203519917-203519939 TCTTAACTGTAAAACGCAGATGG - Intergenic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920878670 1:209860183-209860205 TGCTATCTGTAAAATGGGGATGG + Intergenic
920977851 1:210802700-210802722 TCCCACCTGTAAAATGGAGAGGG - Intronic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
921260959 1:213384689-213384711 CCTTGTCTGTAGAATGGAGATGG - Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921374331 1:214458575-214458597 TCTTATCTGTAAAATGGAGATGG - Intronic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
922053166 1:222014440-222014462 CTTTACCTGTAAAATGGAGAGGG - Intergenic
922375116 1:224955945-224955967 TCTTATCGGTAGAATGAAGGAGG - Intronic
922628446 1:227078026-227078048 ACTTATTTGTAAGATGGAGAAGG - Intronic
923860337 1:237886506-237886528 GCTGAAATGTAGAATGGAGAAGG + Intronic
924465546 1:244296210-244296232 TGCTTTCTGTAGAATGGAGGTGG - Intergenic
1065281111 10:24139663-24139685 TCCTATCTGTGAAATGGAGATGG + Intronic
1065601740 10:27375714-27375736 ACTTAACTGTAGTATGGATAGGG + Intergenic
1065722568 10:28640973-28640995 TCTCATTTGTAAAATGCAGATGG + Intergenic
1066358266 10:34706043-34706065 TCATTTCTGTAGAATGGTGGAGG - Intronic
1067989307 10:51192343-51192365 TCTTATCTGTAAAATAGAATGGG + Intronic
1068151176 10:53134144-53134166 ACTTATCTGTAAAATAGAAACGG - Intergenic
1068635603 10:59344673-59344695 TCCTATCTTTAAACTGGAGATGG - Intronic
1068880051 10:62038652-62038674 TCTTATGTGGAGATTGGACAAGG - Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069743864 10:70702569-70702591 TCTTATCTGTAAAATGGGACTGG + Intronic
1069859691 10:71462628-71462650 TCTTATCTGTCAGATGGAGCTGG + Intronic
1070081522 10:73193288-73193310 TCTCTTCCATAGAATGGAGATGG - Intronic
1070319545 10:75344173-75344195 TCTTGTCTGTAGCACTGAGAGGG + Intergenic
1070372999 10:75803243-75803265 ACTTATCTGTCAAATGAAGATGG + Intronic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1071275133 10:84047253-84047275 CCTGTTCTGTAAAATGGAGATGG + Intergenic
1071549260 10:86553713-86553735 TCTCATCTGAAGACTGGGGATGG + Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072202525 10:93173778-93173800 TCTCATCTATAAAATGGAGATGG + Intergenic
1073069765 10:100785923-100785945 TCTCCTCTGTAAAATGAAGATGG + Intronic
1073913708 10:108377443-108377465 TCTTAATTGTAAAATGAAGATGG + Intergenic
1073919596 10:108443614-108443636 TCTCACCTGTAGAATGGCCATGG + Intergenic
1074063772 10:109993866-109993888 CCCTATCTGTAAAATGGATATGG - Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074571747 10:114631016-114631038 TTTTATCTCTAGAGAGGAGAGGG + Intronic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074899818 10:117806338-117806360 CCTTATCTTTAGAATGGATATGG + Intergenic
1074913886 10:117937647-117937669 TCTCATCTGTAAAATGTTGATGG - Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075406348 10:122198322-122198344 CCTTATCTGTGAAATGAAGAGGG + Intronic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1076230279 10:128814635-128814657 TCTGTTCTGTACAATGGAGAGGG - Intergenic
1078349489 11:10580933-10580955 TCTCATCTGTAAAAGAGAGAGGG + Intronic
1078577846 11:12516811-12516833 TCTTATCTGTAAAACAGGGATGG - Intronic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1079479667 11:20865998-20866020 TCTTTTCAGTAAAATGGGGATGG + Intronic
1079636491 11:22748259-22748281 TATTATCTGTAAAAGTGAGAGGG + Intronic
1079982067 11:27161728-27161750 TATTATCTATAAAAGGGAGATGG - Intergenic
1080302654 11:30801292-30801314 TCTCATCTGTAAAATGGAAATGG - Intergenic
1080677334 11:34439857-34439879 GGTTATCTGTAGAATGTAGAGGG + Intronic
1080682643 11:34490650-34490672 TCTCCTCTGTAGAATGGGGTGGG + Intronic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1080913083 11:36625406-36625428 TCTTATCTGTAGAGTGGTGAGGG - Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1082790770 11:57345487-57345509 TCTCATCTGTCGAATGGGAATGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1084942182 11:72618702-72618724 TCTCATCTGAAAAATGGAGGTGG - Intronic
1085395444 11:76204930-76204952 CCTTATCTGTAAAATGGTGGCGG + Intronic
1085425878 11:76404251-76404273 TCTTATTTATAAAATGGAGATGG - Exonic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1085645988 11:78223255-78223277 TCTTATCTGTGAAATGCAGATGG - Intronic
1085798818 11:79568283-79568305 CCTAATCTGAAAAATGGAGATGG + Intergenic
1085962986 11:81484876-81484898 TCATATCTATAAAATTGAGATGG - Intergenic
1086098356 11:83072351-83072373 TCTTAGCTAAAAAATGGAGAAGG - Intergenic
1086157127 11:83679797-83679819 CTTTATCTGTAAAATGGAGGAGG - Intronic
1087350145 11:97020631-97020653 TTTTGCCTGTAGAAGGGAGAGGG + Intergenic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1087915809 11:103809549-103809571 TCTTGTCTGTAGAGTGGCTAAGG - Intergenic
1088739797 11:112757885-112757907 TCTTCTCTGTAAAATGGGAATGG + Intergenic
1088890319 11:114038882-114038904 TCTCATCTGTAAAATGGAGCTGG - Intergenic
1089480666 11:118802360-118802382 TCTCATCTGTTTAATGGGGATGG + Intergenic
1089846589 11:121463552-121463574 TTTTCTCTGTAGAATGGTCATGG + Intronic
1090007458 11:123015728-123015750 TCCCATCTTTAAAATGGAGATGG + Intergenic
1091328912 11:134715038-134715060 TCAGATCAGCAGAATGGAGAGGG + Intergenic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1091928026 12:4371134-4371156 TCTTTACTGGAGAAAGGAGAGGG + Intronic
1093818428 12:23579589-23579611 TCTTAACTATAAAATGGACATGG + Intronic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094737838 12:33255172-33255194 CCTTATCTGAAGAATTTAGAAGG - Intergenic
1096526274 12:52212109-52212131 TCTCATCTGAAGAATAGAGTGGG + Intergenic
1096655218 12:53086059-53086081 TCTTATCTACAAAGTGGAGATGG + Intergenic
1097335864 12:58382637-58382659 CCTTTTCTGGAGAATGCAGAAGG + Intergenic
1097399652 12:59113677-59113699 TCTTATGCGGAGAAAGGAGAGGG + Intergenic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098455957 12:70672973-70672995 TCTTCTAGGTAGAAGGGAGAAGG + Intronic
1098457008 12:70685851-70685873 TCCTATCTGAAAAATGGGGAAGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1099087267 12:78261043-78261065 GTTTGTCTGTAAAATGGAGATGG + Intergenic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100363318 12:93897650-93897672 TCTTATCTATAAAATAGAAAAGG - Intergenic
1100367683 12:93936630-93936652 TCTCATCTGTAAGATGGAGATGG - Intergenic
1100459500 12:94785185-94785207 TCTAATCTGTAAAATGGAGATGG + Intergenic
1100769549 12:97906468-97906490 TCTTAACTGAAAAATGTAGATGG - Intergenic
1100820889 12:98428544-98428566 TCTTATCTCTAAAACGGGGATGG - Intergenic
1101013277 12:100473212-100473234 CCTCATCTGTAGAATGGATATGG - Intergenic
1101169766 12:102078632-102078654 TCTCATTTCTAAAATGGAGATGG + Intronic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101771636 12:107757121-107757143 TCTTATCAGTAGAAAGAATATGG - Intronic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1102187911 12:110964327-110964349 CCACATCTGTAGAATGGAGATGG - Intergenic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1102735961 12:115159723-115159745 TCTCCTCTGTACAATGAAGATGG + Intergenic
1102996524 12:117355656-117355678 TCTTATCTGTGAAATGGAGTTGG - Intronic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1104096592 12:125563742-125563764 TCTTATCAGAAAAAAGGAGAGGG + Intronic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1105032640 12:132894809-132894831 GCTTATCTGTAATATGGAGCTGG - Intronic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106296923 13:28422890-28422912 CCTTCTCTGTGGAATGGAAAGGG - Intronic
1106606449 13:31233750-31233772 TCTAATCTTTAGAAGGGAAAGGG + Intronic
1106704088 13:32261973-32261995 TCTTCTCTGTAGGTTGCAGATGG + Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1109352098 13:61195840-61195862 TCTAATGTTTAGAAAGGAGAAGG + Intergenic
1109376099 13:61495266-61495288 CCTTATCTGTAAAATAAAGATGG - Intergenic
1109566757 13:64128007-64128029 TCTTATCTGTAAAAAGGATGTGG + Intergenic
1109770873 13:66970808-66970830 ACTTGTATGTATAATGGAGATGG - Intronic
1109900112 13:68757347-68757369 TCTTTTCTGTAGCAAGAAGAGGG + Intergenic
1110105027 13:71662463-71662485 ACTCATCTGTAAAATGGAAATGG + Intronic
1110864536 13:80379566-80379588 TATTCTCTGGAGAAGGGAGAAGG - Intergenic
1111425458 13:88074335-88074357 TCTTATTTGTATCTTGGAGAAGG - Intergenic
1112262757 13:97892419-97892441 TCTCATCTGTAAAATGGATATGG - Intergenic
1112329605 13:98467060-98467082 TCTCATCTGTAGAATGGAGGTGG + Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1114136016 14:19851922-19851944 TGTTATGTGGAGAATGAAGATGG - Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1114652144 14:24292002-24292024 TGCCATCTGTAGAATGGAGCTGG + Intronic
1115170449 14:30499019-30499041 TATTATCTGTAGATAGAAGATGG - Intergenic
1116825604 14:49670527-49670549 TCCTATCTATAGAAGGGGGAAGG - Intronic
1117942390 14:60981817-60981839 TCTTAGCGGTAGAATGGAAGTGG + Intronic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118147784 14:63158583-63158605 TCTCATCTGTAAAATGGAAGGGG + Intergenic
1118313254 14:64708203-64708225 TCCTATCTGTAGGATGGGGGTGG - Intronic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118608173 14:67518343-67518365 TCTCATCTGCAAAATGGAAATGG + Intronic
1118920752 14:70147742-70147764 TCTTATCTGAAGCATGGGGGTGG - Intronic
1119277004 14:73366559-73366581 TCCTATCTGTAAAATTGTGATGG - Intronic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120557764 14:85950150-85950172 TCTTCTTTATAGAAAGGAGATGG + Intergenic
1120599402 14:86482666-86482688 TCTCATCTGTAAAATGGAAATGG - Intergenic
1120841602 14:89090326-89090348 GCTCATCTGTAAAATGGAGTTGG - Intergenic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121258209 14:92546941-92546963 TCTTATTTGTACAATGGAGCTGG - Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1121392912 14:93591217-93591239 TGCTCTCTGTAAAATGGAGATGG + Intronic
1121439511 14:93939866-93939888 CCTTATCTGTAAAGCGGAGACGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121844086 14:97158119-97158141 TCTATTATGAAGAATGGAGAGGG + Intergenic
1202890798 14_KI270722v1_random:155439-155461 TTTTCTCTACAGAATGGAGAAGG - Intergenic
1123711914 15:22994389-22994411 TCCTATCTGTAAAATGGACTGGG - Intronic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1124884827 15:33675624-33675646 TCTCATCTATAAAATGGACATGG + Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125390134 15:39183835-39183857 TCTTAACTGTGGAATCAAGATGG - Intergenic
1125464283 15:39934926-39934948 TCTTAGCTGTAGTAGAGAGAGGG + Intronic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126455087 15:48852417-48852439 TGTTAATTGTAGAATTGAGATGG + Intronic
1126909725 15:53404907-53404929 TCTTATCTGTAAAATGCAGATGG + Intergenic
1127345657 15:58095220-58095242 TCTTATCTATAAAATGGTAATGG - Intronic
1127634654 15:60857869-60857891 TCTCATCTGTGAAATGGAGGTGG - Intronic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1127985090 15:64063313-64063335 TCTTACCTGTAAAATGAAGTTGG + Intronic
1128562438 15:68677700-68677722 TTTTATCTGCAGAATGGACAGGG - Intronic
1128891098 15:71332432-71332454 TCTTGGCTGTAAAATGCAGAAGG + Intronic
1129029145 15:72605787-72605809 TCATATCTGTATAATAGAGGTGG + Intergenic
1129792607 15:78351398-78351420 TTTTATCTGGAAAATGCAGAAGG - Intergenic
1129979104 15:79850078-79850100 TCTCATCCGTAAAATGGAGCTGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130193896 15:81761268-81761290 TATTATCTGTAGAACGGGGATGG - Intergenic
1130431273 15:83849517-83849539 TCCTATCAGAAGAATGCAGATGG - Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131885236 15:96905208-96905230 TCATTTCTCTAGAATGTAGATGG + Intergenic
1133278001 16:4649565-4649587 TCTTAACAGAAGAAAGGAGAGGG - Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133850707 16:9500676-9500698 TCTCACCTGTAAAATGGAGAGGG + Intergenic
1133862598 16:9610199-9610221 CCTCATCTGTTAAATGGAGATGG + Intergenic
1134114137 16:11535472-11535494 GTTTGTCTGTAAAATGGAGAGGG + Intergenic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134351662 16:13443427-13443449 TGTTATCTATAAAATGGGGATGG + Intergenic
1134483393 16:14637460-14637482 TCTCATCTGTAAAATGAACATGG + Intronic
1134781032 16:16895718-16895740 TCTCATCTGTGGAATGGCGGCGG - Intergenic
1135160156 16:20087199-20087221 CCTCATCTGTAACATGGAGAAGG - Intergenic
1135945337 16:26860119-26860141 TCCTCACTGTAAAATGGAGATGG - Intergenic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137776858 16:51062592-51062614 TCCTATCTGTAATATGGACACGG - Intergenic
1137864652 16:51880679-51880701 TGTTCTCTGTAAAATGTAGATGG - Intergenic
1138082915 16:54108758-54108780 TCTTATCTGTCAAGTGGTGACGG - Intronic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138131681 16:54485154-54485176 CCTCGTCTGTAGAATGGATATGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138405795 16:56792986-56793008 TCTTACCTGTAAAATGGGGCAGG + Intronic
1138704590 16:58901872-58901894 TCTTGTCTGTGCAATGGAGTGGG + Intergenic
1138835629 16:60431105-60431127 TCCTATCTGTAAAATGAGGAAGG - Intergenic
1138951047 16:61913640-61913662 TTTTGTTTGTGGAATGGAGAAGG - Intronic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1140589907 16:76339285-76339307 TGTTATATGTTGAATGGGGAGGG - Intronic
1140698005 16:77554185-77554207 TCTTAGCTATAAAATGGAGAAGG - Intergenic
1140971021 16:80012610-80012632 TCTTATTTGCAGAATGGGAATGG - Intergenic
1141050189 16:80754649-80754671 CCTTATCAGTAAAATGCAGATGG + Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141749730 16:85950245-85950267 TCTTAGCTGGAGGGTGGAGAAGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1142363241 16:89637033-89637055 CCTTGTCTGTAAAATGGAGCTGG + Intronic
1142525671 17:538676-538698 TCTTATCTGTGAAATGAAGATGG - Intronic
1143118550 17:4593805-4593827 TCTTCTCTGTGGAAGAGAGAGGG - Exonic
1143385852 17:6530073-6530095 CCTCATCTGTAGAATGGCAAGGG - Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1143844192 17:9760221-9760243 TTTTAACAGTAGAATGGACACGG + Intergenic
1144119165 17:12133468-12133490 CCTTATCTGAGGAATGCAGAAGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144391264 17:14795561-14795583 TCTTGTCTGTAAAATGGAAATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145218002 17:21066634-21066656 GCTGATCTCCAGAATGGAGATGG + Intergenic
1145226266 17:21130789-21130811 TCTTATGTGTATAATGGGGTGGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1146666042 17:34704347-34704369 TCTTCTCTGGAGAGTGGAGCTGG - Intergenic
1146932907 17:36790863-36790885 TCTCATCTGTGAAATGGACACGG - Intergenic
1146950415 17:36901518-36901540 TCTTGTCTGTAAAATGGGGATGG - Intergenic
1147967555 17:44200995-44201017 TCTTATCTCTTGAGGGGAGAGGG - Intergenic
1148173328 17:45542705-45542727 TATTATCTGTAAAATGAATAAGG - Intergenic
1148275940 17:46302746-46302768 TATTATCTGTAAAATGAATAAGG + Intronic
1148298054 17:46520320-46520342 TATTATCTGTAAAATGAATAAGG + Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148362594 17:47024788-47024810 TATTATCTGTACAATGAATAAGG + Intronic
1148588060 17:48794942-48794964 CCTCATCTGTAAGATGGAGATGG + Intronic
1148697746 17:49571165-49571187 TCTAATGGGTGGAATGGAGAGGG - Intergenic
1148717834 17:49728479-49728501 TCTTACCTGGGGAATGCAGAGGG + Intronic
1149214100 17:54334064-54334086 TTTTATCTGAAGAATTTAGAAGG - Intergenic
1149412677 17:56424921-56424943 TCAAATGTGTAGAATTGAGATGG + Intronic
1149830099 17:59864449-59864471 TCTTTTCTGTACAATGAATATGG + Intronic
1150335451 17:64327375-64327397 CCTTATCTATAAAGTGGAGATGG - Intronic
1150404535 17:64889622-64889644 TATTATCTGTAAAATGAATAAGG - Intronic
1151340417 17:73467393-73467415 CCTCATCTGTAACATGGAGATGG + Intronic
1151500240 17:74483728-74483750 TCTTCCCTGTAGAATGGACCAGG + Intronic
1152996814 18:415213-415235 CCTTATCTGTAAAATGGAAACGG - Intronic
1153097412 18:1423322-1423344 CCTTCTCTGTAAAATGGAGATGG + Intergenic
1154103032 18:11494043-11494065 CCCTATCTGTGGAATGAAGAAGG + Intergenic
1155337826 18:24783427-24783449 TCTCATCCGTAAAATAGAGATGG - Intergenic
1155517054 18:26634755-26634777 TCTTCTCCGTAAAATAGAGAGGG - Intronic
1156916423 18:42468044-42468066 TTTTATCTGTAATATGGAGCTGG - Intergenic
1157156180 18:45268712-45268734 TTTCATCTGTTGAATGGAGAAGG + Intronic
1157380256 18:47208073-47208095 TCTTATCTATAAAATGTGGATGG - Intergenic
1157796766 18:50582043-50582065 TCTCATATGTAAAGTGGAGAGGG + Intronic
1157987258 18:52452270-52452292 TTTTATTTGTAGAATGGTAATGG - Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159464248 18:68760060-68760082 TCACACCTGTAGAATGGAGAAGG - Intronic
1160961120 19:1721354-1721376 CCCTATCTGTAAAATGGAGCTGG - Intergenic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1163087409 19:14992381-14992403 TCTTATCTGTAAAAGGGAGCTGG - Intronic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163882095 19:19933930-19933952 TCTTATGTGTAGTAAGGATACGG - Exonic
1164407506 19:27965164-27965186 TCTTATCTGTAAAATGGTGTTGG + Intergenic
1165043674 19:33087079-33087101 ACTTATCTGTAAAATAGAAATGG - Intronic
1165313933 19:35043507-35043529 TCTCATCTGTGAAATGGAGAGGG + Intronic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1167688867 19:50973164-50973186 TCTTATCTGTAAAATGGGAGTGG - Intergenic
1202666218 1_KI270708v1_random:122276-122298 TTTTCTCTACAGAATGGAGAAGG - Intergenic
925218008 2:2113717-2113739 TCCTATCTGTGTAATGGAGGCGG - Intronic
925291705 2:2752307-2752329 TCTCTTCTATAGAATGCAGAGGG - Intergenic
925344821 2:3163782-3163804 TCCTATCTGAAGAACAGAGAAGG + Intergenic
925850137 2:8073122-8073144 CCTAATGTGTAGAAAGGAGAAGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
926855160 2:17248015-17248037 CCTTGTCTGTAAGATGGAGATGG + Intergenic
926908710 2:17829685-17829707 TTCCATCTGTAAAATGGAGATGG - Intergenic
927095276 2:19743625-19743647 TCTGCTCTGTAGAATGGAGATGG - Intergenic
927099089 2:19774050-19774072 TTTTATCTGGGGAATGGAAAAGG - Intergenic
927286249 2:21360101-21360123 TCCTCTCTTTGGAATGGAGAGGG + Intergenic
927562474 2:24083867-24083889 CCTTATCTGTAGAATTAAGATGG + Intronic
927653732 2:24928394-24928416 TTTCATCTGTAAAATGGATATGG - Intergenic
927893732 2:26768287-26768309 TCTCATCTGTAAAATGGACTTGG + Intronic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
928340434 2:30438733-30438755 TCTCTTCTGTATAATTGAGATGG - Intergenic
928712849 2:34026827-34026849 TCTTGTCTGTTGACTTGAGAAGG + Intergenic
928938024 2:36700869-36700891 TTTCATCTGTATAATGGTGATGG - Intronic
929101329 2:38317410-38317432 TCTTTTCTGTATAATTTAGATGG - Intronic
929948835 2:46390677-46390699 TTTTATTTTTAGAATAGAGACGG + Intergenic
930670059 2:54139299-54139321 ACTTAACTGTAAAAAGGAGATGG - Intronic
931014630 2:57962204-57962226 CCTTATCTGTAGGATGAAGAGGG - Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931989099 2:67771639-67771661 CCTCATCTGTCAAATGGAGATGG - Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
932933682 2:76075834-76075856 TGTTATCTGTAGAATGGTCAGGG + Intergenic
933301479 2:80545797-80545819 ACTTATCTGTAGAACGTACAGGG + Intronic
934141943 2:89055231-89055253 GCTTATCTGTAATATGGAGCTGG - Intergenic
934227294 2:90145315-90145337 GCTTATCTGTAATATGGAGCTGG + Intergenic
934479233 2:94619488-94619510 TCTTATCTATAGAAAAGAAAAGG - Intergenic
934577643 2:95413069-95413091 TCTTCTCGGTAGAAGGGAGAAGG + Exonic
934639934 2:96021772-96021794 TCTTCTCGGTAGAAGGGAGAAGG + Intergenic
934793712 2:97083623-97083645 TCTTCTCGGTAGAAGGGAGAAGG - Exonic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
935639687 2:105279097-105279119 TCTTATCTTTAAAAATGAGAGGG - Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
936685747 2:114824123-114824145 TCTTATGTGTGGAATGAAGAGGG + Intronic
936787358 2:116110111-116110133 TCCTATCTCTTGAAGGGAGAGGG + Intergenic
937129092 2:119493939-119493961 TCTGATTTATAGAATGGAGGTGG - Intronic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
937355519 2:121195924-121195946 TCTCATCTGTAAAATGGAACTGG - Intergenic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
938852591 2:135276334-135276356 GCTTATCTCTGGGATGGAGAAGG + Intronic
939154783 2:138511922-138511944 TCTCTTCTGTAAAATGGAAATGG + Intronic
939409408 2:141804793-141804815 TCCCATCTGTACAATGGAAATGG - Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
940899523 2:159113654-159113676 TCTCACCTGGAGAATAGAGAAGG + Intronic
941301225 2:163804377-163804399 TCTTATCTGTGAAATGAATAAGG + Intergenic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
942354263 2:175091266-175091288 TCTTACCTGTAGAATAGATGTGG - Intronic
943562625 2:189482188-189482210 TCCTATTTGTTGAATGAAGATGG + Intergenic
943836204 2:192516779-192516801 TCCTATCTTTACAGTGGAGATGG + Intergenic
943984242 2:194599382-194599404 TCTAATATGTAAAATGAAGATGG - Intergenic
944020737 2:195100590-195100612 ATTCATCTGTAAAATGGAGAAGG + Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944966929 2:204945472-204945494 TCTTATCTATAGAACAGAAAAGG + Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945155271 2:206831483-206831505 TCTTATCTGGAGCACAGAGATGG - Intergenic
945497486 2:210526485-210526507 TCTTATCTGTAAAAGAGAGAAGG + Intronic
945689536 2:213016232-213016254 TCTCATCTGTACAGTGAAGATGG - Intronic
946117441 2:217475730-217475752 TCTTCCCTGTAGAATGGACTTGG + Intronic
946139085 2:217672871-217672893 TCTTAGCTGGAGAATATAGAGGG - Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948025119 2:234770547-234770569 GCTTATATTCAGAATGGAGATGG - Intergenic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948179015 2:235965601-235965623 TCTAATCTGTAAAGTGGAGGTGG + Intronic
1168830635 20:843610-843632 TCTCATCTGTAAAATGGAGGGGG - Intronic
1169277927 20:4246022-4246044 TTTTATCTATAAAATAGAGATGG - Intronic
1169772010 20:9211237-9211259 TCCTATCTGTAAAATGCAGGCGG - Intronic
1170642672 20:18169073-18169095 GCTTATTTGTAGACTGGACACGG - Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1171436637 20:25129918-25129940 CCTTGTCTGTAAAATGGAAATGG + Intergenic
1171453101 20:25249637-25249659 TCTTTTTTCTAAAATGGAGATGG + Intronic
1171977509 20:31604927-31604949 TCTCATCTGTGAAATGGAGCTGG + Intergenic
1172131563 20:32659495-32659517 GCTCATCTGTACAATGAAGATGG - Intergenic
1172168311 20:32912562-32912584 TCCTCTCTGTAAAATGGACATGG + Intronic
1172261973 20:33574800-33574822 TCTTGTAGGTGGAATGGAGAAGG + Intronic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173664176 20:44753384-44753406 CCTTGTCTGTAAAATGGAAATGG + Intronic
1173702585 20:45086018-45086040 TCTGATCTGTAAAATGGGGCTGG + Intergenic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174959281 20:55136750-55136772 TGTTAGCTTTAAAATGGAGATGG + Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175359796 20:58400036-58400058 TCTCATCTCTAAAATGGAGATGG - Intronic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175647362 20:60685871-60685893 TCTTCTCTAGACAATGGAGATGG + Intergenic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1175871484 20:62211435-62211457 TCATATCTGTAGAACGAAGCAGG + Intergenic
1177152365 21:17468122-17468144 GCATATCTGTAAAATGAAGAGGG - Intergenic
1177647232 21:23914878-23914900 CCTCATTGGTAGAATGGAGATGG - Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1177887098 21:26760567-26760589 GATTATTTCTAGAATGGAGATGG + Intergenic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1180874872 22:19170508-19170530 TCCTATCTGAGGAATGGAGCCGG + Intergenic
1181402188 22:22656679-22656701 TCTTCTGTGGAGAATGGAGGTGG - Intergenic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181762825 22:25069639-25069661 TCCTCTCTGTAAAATGGGGATGG + Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182044779 22:27265741-27265763 ACTCATCTTTAAAATGGAGATGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182264861 22:29106550-29106572 TCTTATCTGAGAAATGGAGGCGG - Intronic
1182580173 22:31303622-31303644 CTTTATCTGTAAAATGGATAGGG + Intergenic
1182581343 22:31313777-31313799 CCCTATCTTGAGAATGGAGATGG + Intergenic
1182820065 22:33207975-33207997 TCTTTTCTTTAGACTGGAGAGGG + Intronic
1182893251 22:33836753-33836775 TTTTATCTGTAAAATAGGGATGG + Intronic
1183003777 22:34883264-34883286 CCTTATCTGTAAGATGTAGAAGG + Intergenic
1183114834 22:35683388-35683410 CCTTATATGCAGATTGGAGAAGG + Intergenic
1183352249 22:37340840-37340862 TCTCATCTGTATCATGGAGTTGG - Intergenic
1183687829 22:39371890-39371912 TCTTATCTGCAAAATGCTGATGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184986168 22:48136847-48136869 TATTATCTGTAGAAAGGAATGGG + Intergenic
949894200 3:8757160-8757182 CCTTATCTGTAGCATGGAGGCGG + Intronic
950106629 3:10392810-10392832 TGTCATCTGTAGAGTGGGGAGGG + Intronic
950222143 3:11204721-11204743 TCTCATTTGTAAATTGGAGATGG - Intronic
950240432 3:11365109-11365131 TCTTATCTGTAACATAGAGAAGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950771016 3:15311253-15311275 TCTTATCTGTAAACTCGGGATGG - Intronic
951214264 3:20008822-20008844 TCTTATCTGTAAAATGCACAAGG + Intronic
951240477 3:20280734-20280756 TCTTATCTGAGGAATTTAGAAGG - Intergenic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951294028 3:20911473-20911495 TCCTATCTGTAGAATGCTAACGG + Intergenic
951374162 3:21892180-21892202 TCTTATTTTTATAATTGAGATGG + Intronic
951600803 3:24372701-24372723 TCCTGTCTGTAAAATGGGGATGG - Intronic
951658533 3:25036373-25036395 TTTTTACGGTAGAATGGAGAGGG - Intergenic
951762151 3:26159344-26159366 GCTTATCTGTAATATGGAGCTGG + Intergenic
952257753 3:31710179-31710201 TCCTGTCTCTAAAATGGAGATGG + Intronic
952956838 3:38562850-38562872 TCCCATCTGTAGAATAGAGGTGG - Intronic
952966055 3:38621975-38621997 TCTCATCTGTGCAATGGGGAAGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954967970 3:54627635-54627657 TCTTATGTTTTGAATGTAGAAGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955708531 3:61754264-61754286 GCTCAGCTGTAAAATGGAGATGG + Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
955762050 3:62296734-62296756 ACTTATCTCTAGAAAGAAGAAGG + Exonic
955931988 3:64066592-64066614 ACTGAACTGCAGAATGGAGAAGG + Intergenic
955959621 3:64326869-64326891 TCTTGTCTGAGGGATGGAGAAGG + Intronic
955959815 3:64328711-64328733 TGTTATCTGTAAAATGGGAAGGG - Intronic
955998386 3:64701633-64701655 TCTTATCTGGTGAATGGAAGAGG + Intergenic
956882597 3:73526371-73526393 CCTTATCTGTGGAATGGGTATGG - Intronic
957089661 3:75717094-75717116 TTTTCTCTAAAGAATGGAGAAGG + Intronic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959080401 3:101794883-101794905 TCTTCTCTACTGAATGGAGAAGG + Intronic
959164272 3:102757763-102757785 TATTTTCTGTAAAAAGGAGAGGG - Intergenic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
960033466 3:113078781-113078803 TCTTATATGAAGTATGGAGCTGG - Intergenic
960073115 3:113453940-113453962 TCTTATCTATAGTATTGAGAAGG - Exonic
961105392 3:124236619-124236641 TCTTTTCTTTAGAATAAAGAGGG + Intronic
961773400 3:129266807-129266829 CCTTATCTATTTAATGGAGAAGG - Intronic
961816059 3:129550982-129551004 TCTTATCTGTAAGATGGGGATGG - Intronic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
962786147 3:138769871-138769893 TCTTATCTTTAAAATGGGTAGGG - Intronic
963059045 3:141210019-141210041 GCTTATCTGTAATATGGAGCTGG - Intergenic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963320417 3:143804180-143804202 GCTTATCTGTAATATGGAGCTGG - Intronic
963843276 3:150130012-150130034 CTACATCTGTAGAATGGAGATGG + Intergenic
964098434 3:152961176-152961198 TCTTACCTGCAGAATGTACAGGG - Intergenic
964742502 3:159982457-159982479 TCATATCAGCAAAATGGAGATGG - Intergenic
964934407 3:162063677-162063699 GCTTATCTGTGGATTGGACAAGG + Intergenic
965638721 3:170811081-170811103 CCTTATCTGTAAAATGGAGGTGG + Intronic
965772600 3:172196577-172196599 TCTCATCTGTAAAATGGAGGTGG + Intronic
965789621 3:172373407-172373429 TCTTATATGTAGAATGACCAGGG - Intronic
966396049 3:179504446-179504468 TCTTATCTATAGGCTGGAGGTGG - Intergenic
966649496 3:182283454-182283476 TTTTATTTGTAGAATGAAGAAGG + Intergenic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
966958158 3:184906607-184906629 TCTTAGGGGTAGAAGGGAGATGG + Intronic
967189038 3:186969554-186969576 ACTTATCTGTAGAATATATAAGG - Intronic
967415103 3:189208103-189208125 TCTTACCTGTGCAATGGAGCTGG + Intronic
968466755 4:755688-755710 CCTTGTGTGTAGAATGGACAAGG + Intronic
968996037 4:3946468-3946490 TCTCATCTATAAAATGGAGGTGG - Intergenic
969148926 4:5151781-5151803 TCTCATCTGTAAAATGGAAAGGG + Intronic
969364360 4:6685622-6685644 TCTCATCTGTAAAATGGATGGGG - Intergenic
970254366 4:14152118-14152140 TCTTACCTGGAGGATGGAAATGG - Intergenic
970654729 4:18218615-18218637 TCTTACCTGTAGTAGGCAGAGGG + Intergenic
970881876 4:20942295-20942317 TTTTATCTGGAGGATGGAGATGG - Intronic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
971584663 4:28389918-28389940 TGTTATATGTACCATGGAGAGGG - Intronic
972347604 4:38205951-38205973 TCTTATCTCTTGAATAGGGAGGG - Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972675845 4:41258134-41258156 ACCTAGCTGTAGAATGGAGGGGG + Intronic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
974647552 4:64714764-64714786 TCTTATCTGTAGTAAGGCCAAGG + Intergenic
975512785 4:75211783-75211805 TCTCCTCTGTAAAATGGAAAAGG + Intergenic
975780320 4:77832342-77832364 TATTATCAGTAAAATGGAGTTGG + Intergenic
978142634 4:105335029-105335051 TCTCATCTGTACAATGATGAAGG + Intergenic
978449583 4:108817156-108817178 TCTTTTCTTTGGAATGGAAAGGG - Intronic
978827680 4:113044407-113044429 TCTAACCTGTAGAATGTAGGTGG - Intronic
981411104 4:144433723-144433745 TCTTATCTGTAAAATGGGAATGG - Intergenic
981576241 4:146208738-146208760 TCTCATCTGTAAAGTGGAAATGG + Intergenic
981780661 4:148425879-148425901 TCATATCTGTAAAATAGTGACGG + Intronic
982075032 4:151730405-151730427 CATTAGCTGTAGTATGGAGAGGG - Intronic
982342062 4:154310622-154310644 TGTTTTCTGTAGACTGGGGATGG + Intronic
983160260 4:164404688-164404710 TCTAATATGTAAAATGAAGATGG - Intergenic
984484552 4:180351924-180351946 TCTGATGTCTAAAATGGAGATGG - Intergenic
984936617 4:184895374-184895396 TCTTTTTTGTAGGATGGGGAGGG + Intergenic
985565573 5:613879-613901 TATTATCTGTAGAGTGGTTAAGG + Intronic
986835759 5:11635265-11635287 TGTTATCTTTAGAAAGAAGAAGG + Intronic
987013137 5:13788279-13788301 TGTTATCTGTAGAATGGCTTGGG - Intronic
988536156 5:32071015-32071037 TCTGCTCTGTAGATTGAAGAAGG + Intronic
989529677 5:42493260-42493282 GGATTTCTGTAGAATGGAGAAGG + Intronic
989553519 5:42763864-42763886 TTTTATTTTTATAATGGAGAAGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990559252 5:56967110-56967132 TCTTTTCTTTATAATAGAGATGG - Intronic
990976516 5:61565894-61565916 TCTTACCTGTAGCGTGGAGGTGG - Intergenic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
991950506 5:71943015-71943037 TCTTATCTGTAAAATGCATAGGG - Intergenic
993050174 5:82917308-82917330 TCTTATTTGTTAAATGGAGATGG + Intergenic
993336367 5:86664624-86664646 GCTTATCTGTAAAATGGAAGAGG + Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
994003061 5:94804315-94804337 TCTTACCTATAAAATGGAGATGG + Intronic
994294828 5:98078387-98078409 CCTTATTTGTAAAATGGAGATGG - Intergenic
994829509 5:104760912-104760934 GCTCATCTGTAGATTGGACATGG + Intergenic
995074428 5:107965549-107965571 TCTTATCTATACCTTGGAGAAGG - Intronic
995269267 5:110202930-110202952 TTTTATCTCTAAAATGTAGATGG + Intergenic
995441929 5:112201916-112201938 TCTCATCTGTAAAACTGAGATGG + Intronic
996809078 5:127494027-127494049 ACTTATCAGTAGACTGGACATGG + Intergenic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997663004 5:135603724-135603746 ACTTATTTGTTGAAAGGAGAAGG + Intergenic
997778995 5:136638348-136638370 TTTCATCTGTAGACTGGAGATGG - Intergenic
998377691 5:141702168-141702190 TCTTAGCTGTAAAATGGGCACGG + Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998513757 5:142735004-142735026 ATTTATCTGCAGAAAGGAGAAGG + Intergenic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
998707429 5:144779287-144779309 TCTTTTCTCTAGATTGGAAAGGG + Intergenic
999168942 5:149576413-149576435 TCTCATTTGTAGAAAGAAGATGG + Intronic
999271671 5:150300270-150300292 TATCATCTGTAGAATGGGGGTGG - Intronic
999577914 5:153000783-153000805 GCTGAAATGTAGAATGGAGAAGG - Intergenic
999587678 5:153108926-153108948 TGACATCTGAAGAATGGAGAAGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999942474 5:156559114-156559136 TCTCATCTGTACAATGAAAATGG + Intronic
1000023711 5:157340869-157340891 TCCCATCTATAGAAAGGAGACGG + Intronic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000186041 5:158859077-158859099 TCTTGTATGGAAAATGGAGAGGG - Intronic
1000961777 5:167609205-167609227 TGTTATCTGTACAATGGGTATGG - Intronic
1001019115 5:168167810-168167832 TCTTATCTGTAAAATAGGCATGG + Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001439369 5:171727727-171727749 TCTAATCTGTAGAAAAGAGAGGG + Intergenic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001941226 5:175741075-175741097 TCTCATCTGTTTGATGGAGATGG - Intergenic
1003002949 6:2353304-2353326 CCTTTTCTGTAGAATAGAGTTGG - Intergenic
1003205247 6:4003396-4003418 TCTTAACTATAAAATGAAGAAGG - Intergenic
1003249815 6:4416437-4416459 TCTTACTTGTAAAGTGGAGATGG + Intergenic
1003431241 6:6039855-6039877 ACTTTTCTGTAGGCTGGAGATGG + Intergenic
1003440293 6:6134620-6134642 TCTTATCTGAAGGATTGAGTGGG - Intergenic
1005240151 6:23815586-23815608 TTTTGTGTGTAGAATAGAGAAGG - Intergenic
1005889699 6:30127163-30127185 CCCTATCCGTAGAATGGAGACGG + Intergenic
1005945640 6:30593410-30593432 TCTCATCTGTAAAATGAAGGTGG + Intronic
1006005146 6:30996084-30996106 GCTCATCTATGGAATGGAGATGG + Intergenic
1006135464 6:31893130-31893152 TCTCATCTGTAAAATGGAAAAGG - Intronic
1006590814 6:35155558-35155580 TCTTATATGTAAAATGGTGAAGG - Intergenic
1007053443 6:38857022-38857044 ACTTATCTATAGAAGAGAGAGGG - Intronic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007403094 6:41615792-41615814 TCTCATCTGTAAAGTGGAGCTGG + Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008010483 6:46461897-46461919 TCTTGACTGCAGAATGGAGAAGG + Intronic
1008055605 6:46942516-46942538 TCTTATGTGTAAAAGAGAGACGG + Intronic
1008299572 6:49818561-49818583 CATTATCTGTAAAATGGAGATGG + Intergenic
1008445394 6:51583755-51583777 TCTCATCTGTAGAAATGAGTAGG - Intergenic
1009343849 6:62590028-62590050 TCTTGTCTGTAATATGGAGCTGG - Intergenic
1010084998 6:71906753-71906775 TCTTATTTGTGAAATGGGGATGG + Intronic
1010515713 6:76770681-76770703 TCTTATCTGTAGAAGAGGAAAGG - Intergenic
1010952659 6:82055565-82055587 TCTAATCTGTAAAATGGGGTTGG - Intergenic
1011128608 6:84032842-84032864 TCTCATCAGTAAAATGGAAATGG + Intergenic
1011166025 6:84447347-84447369 TCTTACCTGTAGAATGAACATGG + Intergenic
1012530813 6:100233612-100233634 TCTTATCTGTAGAATCCAGTAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1013688777 6:112615973-112615995 AGTTTTCTGTAGAATGGAGCAGG + Intergenic
1015025521 6:128527749-128527771 GCTTATTTGAAAAATGGAGAAGG + Intergenic
1015267913 6:131307631-131307653 TCTTGTCTGTGGAATAGGGAGGG - Intergenic
1015306535 6:131715293-131715315 GCTTATGTGTAGAATGGAGAAGG - Intronic
1015373106 6:132478626-132478648 GCCTATCTGGAGAATGCAGAAGG + Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1015744350 6:136493929-136493951 TCATGTCTGTAAAATGGGGAAGG + Intronic
1017224548 6:152005678-152005700 TCCTGTCTGTAAAATGCAGATGG - Intronic
1017364863 6:153623579-153623601 TCTACTTTGTAGAAAGGAGAGGG - Intergenic
1018182935 6:161240474-161240496 TCTTCTCTGTAGATGGGAGTTGG - Intronic
1018826100 6:167408850-167408872 TCTTATTAATAAAATGGAGATGG - Intergenic
1018892557 6:167992880-167992902 CCTTTTCTATAAAATGGAGACGG - Intergenic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020711044 7:11605506-11605528 TCTGATTTGTAGCATGGAGCGGG - Intronic
1020766718 7:12331192-12331214 TCTTATCTGTAGTAGGAAGAAGG + Exonic
1021364085 7:19754486-19754508 TCTAATCAGTAGAATACAGATGG + Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021610016 7:22447894-22447916 GCTCATCTGTAAAAAGGAGATGG - Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1022185361 7:27962005-27962027 CCTTATCTATAAAATGAAGATGG + Intronic
1022633364 7:32107059-32107081 ACTCATCAGTAGAATGGACATGG + Intronic
1022653074 7:32294504-32294526 TCTCATCTGTAAAATGAACAGGG + Intronic
1023056121 7:36291433-36291455 TCGTACCTGCAGAAGGGAGATGG + Intronic
1023375306 7:39549852-39549874 CCTTATCTATAAAATGGAGAGGG + Intergenic
1023642829 7:42277923-42277945 CCACAGCTGTAGAATGGAGAAGG + Intergenic
1023837331 7:44076041-44076063 CATTTTCTGTAAAATGGAGAAGG - Intronic
1024177971 7:46860754-46860776 CCTTCACTGCAGAATGGAGATGG - Intergenic
1024378821 7:48670645-48670667 TCTTCTCCGTACAATGGATATGG + Intergenic
1024464675 7:49699846-49699868 TCTTATCTATAGAATTGTGAAGG + Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1027227406 7:76252782-76252804 TCTCATCTGCAAAATGGAAAGGG + Intronic
1027400596 7:77801912-77801934 CCTTATCTGTTTAATGGAAAGGG + Intronic
1027522209 7:79223516-79223538 TCTTGTCTGAAAAATGGAGATGG - Intronic
1028208826 7:88048812-88048834 AATTATCTGTAGAATGTAGAGGG - Intronic
1028828357 7:95300289-95300311 TCTCATCTGTAGAATGAAATGGG + Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029676362 7:102071841-102071863 TCTCATCTGTAAAATGGAACAGG + Intronic
1029790300 7:102836430-102836452 TCTTATCTGTAGGGGGGAAATGG - Intronic
1029818659 7:103123677-103123699 TCTTAGCTGTAGAATGGAGCTGG - Intronic
1029900492 7:104034278-104034300 ACTTATCTGTAAATTGGAGTTGG - Intergenic
1030562751 7:111111461-111111483 CCTTATGTGTTGAATAGAGAGGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1031008139 7:116497856-116497878 TCTCATCAGGAGAATGGACAAGG + Intronic
1031085211 7:117295801-117295823 TCTTATCTGTACAATGGAGAAGG + Intronic
1031601382 7:123714849-123714871 TCTTACCTGAAGAATGAAAAAGG + Intronic
1031697895 7:124882946-124882968 TTTCATCTAAAGAATGGAGATGG - Intronic
1031872749 7:127104585-127104607 ACTTATCTGGGGAATGGAGGAGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1032857327 7:135846287-135846309 TCTCATTTGTAAAATGAAGAGGG - Intergenic
1033679792 7:143583234-143583256 GCTTATATGTAGAATGGAGAAGG - Intergenic
1033692043 7:143746209-143746231 GCTTATATGTAGAATGGAGAAGG + Intergenic
1033731014 7:144179207-144179229 GCTTATGTGTAGAATGGAGAAGG + Intergenic
1035947126 8:3977651-3977673 TCTTATGAGCAGAAAGGAGAAGG - Intronic
1037748322 8:21663593-21663615 TCTCATCTGTCAAATGGAGATGG - Intergenic
1038524068 8:28258197-28258219 CCTTGTCTGAAAAATGGAGATGG + Intergenic
1038664676 8:29527983-29528005 TCTTATCTGTAAAGTGGGAAAGG + Intergenic
1039731119 8:40279828-40279850 ACTTATTTGTAGACTGGACATGG - Intergenic
1040087041 8:43354738-43354760 TCTTATAGGTAGCATGGAGTAGG + Intergenic
1040088494 8:43370158-43370180 TCTTATAGGTAGCATGGAGTAGG + Intergenic
1040360767 8:46662133-46662155 CTTTATCTCTAGTATGGAGATGG + Intergenic
1040406019 8:47103224-47103246 TCTTATAGGTAGCATGGAGTAGG - Intergenic
1040922658 8:52640624-52640646 TCCTATATGTAGAATGAAGTTGG + Intronic
1041102358 8:54409233-54409255 TCTTATCTGTGAGATGAAGATGG + Intergenic
1042413578 8:68492974-68492996 CCTTCTCTGTAAAATGTAGATGG + Intronic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1043548667 8:81344051-81344073 TCTGACCTGTAGACTGGAAATGG - Intergenic
1043980984 8:86639037-86639059 CTTTATCTGTAAAATTGAGAAGG + Intronic
1044350841 8:91164707-91164729 TATCATCTGTAAAATGGAAATGG - Intronic
1044510691 8:93074996-93075018 TCTTCTCTGTTGAGTGGATATGG + Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044933449 8:97271677-97271699 TCTGATATGTGGAATGCAGAAGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045259334 8:100558804-100558826 CCTTATCTGTATAATGGAAATGG + Intronic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045569155 8:103351880-103351902 TCTTTTGTGGAGAAAGGAGATGG - Intergenic
1046392678 8:113596877-113596899 TTTAATCCTTAGAATGGAGAAGG - Intergenic
1047301927 8:123620935-123620957 TCCCATCTGTAGAATGGGAATGG + Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047621196 8:126609852-126609874 TTTTATCTGTAAAAATGAGAAGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1048667251 8:136676335-136676357 TCTCATCTGTAAAATAGAGTTGG + Intergenic
1049119210 8:140719233-140719255 TCGTATCTTGAGAATGGAGTGGG - Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1052243583 9:26305901-26305923 TATTATCTTCAGAATGGAGGAGG - Intergenic
1052576823 9:30301540-30301562 TCCTGTCTGTAGTATGGCGAAGG - Intergenic
1052732322 9:32303530-32303552 TCTTTTTTCTAGAATGCAGAGGG - Intergenic
1053138331 9:35665498-35665520 TCCTATCTGGAGAATTGGGACGG + Intronic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053678593 9:40464077-40464099 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1053928579 9:43092431-43092453 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1054285131 9:63160865-63160887 TCTTATCTATAGAAAAGAAAAGG - Intergenic
1054291671 9:63299615-63299637 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1054389687 9:64604158-64604180 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1054506025 9:65912218-65912240 TCTTATCTATAGAAAAGAAAAGG - Intergenic
1054830661 9:69621061-69621083 CCTGATCTGTAAAATGGAGTTGG + Intronic
1054918244 9:70515876-70515898 TTTTATTTTTAGTATGGAGAAGG + Intergenic
1055289638 9:74769450-74769472 TCTTATTTGTAAAATAGACATGG - Intronic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056466562 9:86861425-86861447 GCTTATCTGTTCAATGGAGATGG + Intergenic
1056736961 9:89218231-89218253 TGTTATCTGCAGCATTGAGATGG + Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057507224 9:95644985-95645007 TCTTGGCTGCAGAATAGAGAAGG + Intergenic
1057621026 9:96635211-96635233 TCTTCTCTGCAAAATGGTGATGG + Intergenic
1057640893 9:96820299-96820321 TGTGATGTGTAGAATGGAAATGG - Intronic
1057968685 9:99531407-99531429 TCTCATCTGTCTGATGGAGATGG + Intergenic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058956068 9:109949951-109949973 GCTTATGTGTAGACTGAAGATGG - Intronic
1059288162 9:113195870-113195892 TTTTTTCTGTAGAATGGAAATGG - Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059651475 9:116319679-116319701 TCTCATCTGCAGAATGGACTGGG + Intronic
1059694344 9:116716497-116716519 TCCCATCTGTAGAATGGGAATGG + Intronic
1059923316 9:119181469-119181491 TCTTATCTGTCAAATGGGGAAGG + Intronic
1060153742 9:121304735-121304757 TCTCATCTGTAAAATGGAATGGG - Intronic
1060238445 9:121883251-121883273 TCTCTTCTGTAAAATGGAGATGG + Intronic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060571240 9:124642365-124642387 TATTATCTATAAAATGGGGATGG + Intronic
1060959290 9:127668065-127668087 TCTCATACCTAGAATGGAGACGG - Exonic
1061659454 9:132119126-132119148 TCTCATCTGTAGCATTGAGATGG + Intergenic
1061884417 9:133584371-133584393 TCTTATCTGTACAATGGGTGTGG + Intronic
1061894559 9:133640438-133640460 GCCCATCTGTAAAATGGAGATGG + Intronic
1062255358 9:135618239-135618261 CCACATCTGTAGAGTGGAGACGG - Intergenic
1185704987 X:2260206-2260228 TCTTATATGTAGAGTGGGGTCGG + Intronic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186179056 X:6954980-6955002 TCTTATCAGTGGAATGTAGGGGG - Intergenic
1186553884 X:10536640-10536662 TCTTTTCTGTAGAATCTAGAAGG + Intronic
1186586840 X:10884317-10884339 TGTTAACTGTGGAATGTAGAGGG - Intergenic
1187614137 X:20974735-20974757 TGACATTTGTAGAATGGAGATGG - Intergenic
1189035948 X:37493483-37493505 TCTGCTCTGAAGAATGTAGAGGG + Intronic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190702801 X:53000734-53000756 TCAGATCTGTAGAACGGAGACGG + Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1193691393 X:84648897-84648919 TATTATTTGTAGAATGTAGGTGG - Intergenic
1193801020 X:85936439-85936461 TCTTACCTGTATTATGGAAAAGG - Intronic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1195767770 X:108314777-108314799 TCCTATCTGTAAAATGAGGATGG + Intronic
1196566714 X:117214902-117214924 TCTAATCTGTAGAATCTATAAGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196919218 X:120568743-120568765 TCTTATCTGTACAGTGGGGATGG - Intronic
1197722533 X:129755047-129755069 TCCTATCCGTAAAATGGAGGTGG + Intronic
1197899431 X:131354278-131354300 TCTTGTCTTTAGATTGGTGAGGG + Intronic
1198301622 X:135339177-135339199 TCTTATCTGTTGAAGATAGAGGG - Intronic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198445116 X:136705551-136705573 TCTTATCTGTAAAGCAGAGATGG + Intronic
1200336094 X:155353110-155353132 TTTCATTTGTAAAATGGAGATGG - Intergenic
1200350376 X:155488117-155488139 TTTCATTTGTAAAATGGAGATGG + Intergenic
1200691818 Y:6313088-6313110 TGATATCTGTAGAAGTGAGATGG + Intergenic
1200887812 Y:8287304-8287326 TGTTATCTGTATAAGTGAGATGG + Intergenic
1201043454 Y:9861635-9861657 TGATATCTGTAGAAGTGAGATGG - Intergenic