ID: 1125200220

View in Genome Browser
Species Human (GRCh38)
Location 15:37096135-37096157
Sequence CAGGCTCAGGGATGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1204
Summary {0: 1, 1: 1, 2: 7, 3: 125, 4: 1070}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125200205_1125200220 8 Left 1125200205 15:37096104-37096126 CCCATATTTATCTCCACTTCCAA 0: 1
1: 0
2: 0
3: 24
4: 368
Right 1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG 0: 1
1: 1
2: 7
3: 125
4: 1070
1125200208_1125200220 -5 Left 1125200208 15:37096117-37096139 CCACTTCCAATTCGCCCCCAGGC 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG 0: 1
1: 1
2: 7
3: 125
4: 1070
1125200206_1125200220 7 Left 1125200206 15:37096105-37096127 CCATATTTATCTCCACTTCCAAT 0: 1
1: 0
2: 1
3: 25
4: 332
Right 1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG 0: 1
1: 1
2: 7
3: 125
4: 1070

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125200220 Original CRISPR CAGGCTCAGGGATGGGGAGG AGG Intronic
900161893 1:1227794-1227816 GAGACTCAGGGATGGGGTCGGGG + Intronic
900299473 1:1969663-1969685 CAGGCTAAGGGATGTATAGGCGG + Intronic
900422450 1:2561480-2561502 CAAGCTCGGCTATGGGGAGGTGG - Intronic
900435687 1:2629525-2629547 CAGGCCCAGGGCAGGGGAGAGGG + Intronic
900476904 1:2880253-2880275 GAGGCTCAGGGAGGGGGCGGTGG + Intergenic
900520372 1:3102472-3102494 GCAGCTCAGGGATGGGGATGCGG - Intronic
900619633 1:3580838-3580860 CAGGCTCCGGGGTGGGGCAGGGG - Intronic
900678691 1:3904209-3904231 CAGGATGAGGGAGGGAGAGGGGG - Intergenic
900783400 1:4632273-4632295 GAGGCTCTGGGATGAGGACGTGG + Intergenic
900899779 1:5508738-5508760 AGGGCTCAGGGGTGGGGAGGTGG - Intergenic
900926433 1:5709183-5709205 CAGGCTCAGGTTGGGGCAGGTGG + Intergenic
900929729 1:5729016-5729038 CAGGGGTGGGGATGGGGAGGCGG - Intergenic
900940405 1:5795039-5795061 CAGGGTGAGGGAGGGAGAGGAGG + Intergenic
900996156 1:6124656-6124678 TAGGCTCTGGGGTGGGGGGGGGG + Exonic
901207800 1:7507378-7507400 CAGGCTGCAGGCTGGGGAGGGGG + Intronic
901230977 1:7641598-7641620 CAGCCTCAAGGTTGGGGATGAGG + Intronic
901263110 1:7888325-7888347 CAGTCTGAGGGATGGGGAGGAGG - Intergenic
901641397 1:10694769-10694791 CTGGCTCCGGGAGGAGGAGGCGG + Intronic
901684236 1:10934866-10934888 AAGGCTGAGGGAAGGGGTGGGGG - Intergenic
901742128 1:11348958-11348980 AAGGGTCAGGGATGGGGTTGGGG - Intergenic
902129125 1:14243371-14243393 CAGTCTCTGGGAGGTGGAGGAGG + Intergenic
902242081 1:15095993-15096015 TGGGCTGAGGGATGGGGAGGAGG + Intronic
902277313 1:15349305-15349327 GAAACTGAGGGATGGGGAGGTGG - Intronic
902311871 1:15587242-15587264 CAGGATCAGAGACAGGGAGGTGG - Intronic
902431522 1:16367213-16367235 CAGGCGCGGGGAGGGGGTGGGGG + Exonic
902553921 1:17235596-17235618 CAGGCTCAGGGGCGGAGAGCCGG + Intronic
902614400 1:17616006-17616028 CAGGCCGAGGCCTGGGGAGGCGG + Intronic
902642450 1:17775418-17775440 CAAGCACCGGGCTGGGGAGGTGG + Intronic
902683340 1:18059086-18059108 CAGGCCCAGCCAAGGGGAGGTGG - Intergenic
902799260 1:18819343-18819365 CGGACAGAGGGATGGGGAGGGGG - Intergenic
902806384 1:18863694-18863716 CAGTCTCAGGGTTTGGGACGGGG + Intronic
903257520 1:22112887-22112909 CATGCTCCTGTATGGGGAGGAGG + Intergenic
903365665 1:22804229-22804251 CAGGCACAGTGCTGGGCAGGAGG - Intronic
903386443 1:22930181-22930203 GAGGCTCAGGTAGGAGGAGGAGG + Intergenic
903462853 1:23531155-23531177 GATGCGCTGGGATGGGGAGGGGG + Exonic
903694247 1:25195694-25195716 CAGCCTCAGGGATGTGCCGGGGG - Intergenic
903856849 1:26342902-26342924 CAGGATCACAGATGGGGAGGAGG + Intronic
903860391 1:26361069-26361091 CAGGCTCAGGGAAGGCGTGGAGG - Intergenic
903994740 1:27298754-27298776 CTGGCTGGGGGATGGGGGGGCGG - Intronic
904036587 1:27562243-27562265 CAGGCTCGGGGGTCAGGAGGCGG - Intronic
904082358 1:27880136-27880158 GATCCTCAGGGATGGGGTGGGGG - Intronic
904090404 1:27941078-27941100 CAGGACCATGGATGGGGAGGTGG - Intronic
904630854 1:31841000-31841022 AAGGCTCAGGGTTGGGAAAGAGG + Intergenic
904650651 1:32003529-32003551 CAGGCCTGGGGCTGGGGAGGGGG - Intergenic
904650655 1:32003535-32003557 CAGGCTCAGGCCTGGGGCTGGGG - Intergenic
904778186 1:32924831-32924853 CGGGGTAAGGGATGGGGATGTGG + Intergenic
904810835 1:33162524-33162546 CAGGCTCTGGGATGGGCACAGGG - Intronic
904825073 1:33268986-33269008 CTGGATCAGGGCAGGGGAGGTGG + Intronic
904890269 1:33774345-33774367 CAGGCTCAGGGATGGGGGAGGGG + Intronic
904896693 1:33823161-33823183 CTGGCTGAGGAAAGGGGAGGCGG - Intronic
904937029 1:34138415-34138437 GAGGCTCAGGGAGGTGAAGGAGG - Intronic
904940881 1:34164447-34164469 CAGACGCAGAAATGGGGAGGGGG + Intronic
904947977 1:34213252-34213274 AAGGTTCTGTGATGGGGAGGTGG - Intronic
905023829 1:34836511-34836533 GAGGCTCAGGGGTGGGGACAGGG - Intronic
905263140 1:36733130-36733152 CCTGCTCAGGGCTGGGCAGGAGG + Intergenic
905283148 1:36861825-36861847 CAGGATCTGGGATGGGGAAGGGG + Intronic
905482502 1:38271288-38271310 CAGCCTCAGGTGTGGGGATGGGG - Intergenic
905768405 1:40622049-40622071 CAAGCTCAGGGTTCGGGGGGAGG + Exonic
905886491 1:41494724-41494746 CAGGCCCAGGGCTGGGGCTGTGG + Intergenic
906662487 1:47592983-47593005 CAGGCTCTGGGAGAGAGAGGGGG + Intergenic
906755004 1:48303428-48303450 CAGGGACTGGGAAGGGGAGGAGG - Intronic
907287185 1:53389435-53389457 GTGGCCCAGGGGTGGGGAGGGGG + Intergenic
907310660 1:53537180-53537202 CAAGCTCTGGCTTGGGGAGGGGG + Intronic
907388348 1:54140107-54140129 CTGGATGGGGGATGGGGAGGTGG + Intronic
907670702 1:56472710-56472732 CAGGCTCAGGGTAGGGGTGAGGG - Intergenic
907885186 1:58586409-58586431 CAGGCGCAGGGAGGAGCAGGAGG - Intergenic
907906404 1:58785994-58786016 CAGGCACTGAGCTGGGGAGGGGG + Intergenic
908703923 1:66930416-66930438 CCGGCTCCGGGACAGGGAGGGGG - Intronic
909222793 1:72984250-72984272 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
910163052 1:84294426-84294448 CAGGCATGGGCATGGGGAGGTGG - Intergenic
910434518 1:87191624-87191646 CAGGCACAGTGACAGGGAGGAGG + Intergenic
910784631 1:90983087-90983109 TAGTTTCAGGTATGGGGAGGAGG - Intronic
910874198 1:91862654-91862676 CAGGCTCAGGGATAGAGGGCTGG - Intronic
911146219 1:94554894-94554916 CAGGCTCCGGGATGGCCATGGGG - Intergenic
912522918 1:110258850-110258872 GAGGCTGAGGGCTGGGGAGCTGG - Intronic
912624681 1:111197330-111197352 AAGGCTGAGGGCTGGGGAGGGGG + Intronic
912703393 1:111894997-111895019 CAGGGGGAGGGAAGGGGAGGAGG + Intronic
912801394 1:112722124-112722146 GAGGCACAAAGATGGGGAGGAGG - Intronic
912877055 1:113370769-113370791 CATGTGCAGGGCTGGGGAGGTGG - Intergenic
912908031 1:113728082-113728104 CCGTCTCAGGGATGGCGGGGCGG + Intronic
913191086 1:116413584-116413606 AAGCCTCAGGGGTTGGGAGGAGG + Intergenic
914349791 1:146831248-146831270 GAGGGCCAGGGATGGGAAGGGGG - Intergenic
914490376 1:148147469-148147491 CAAGCACAGGGCTGGGGACGTGG - Intronic
914686108 1:149981067-149981089 CTGTCTCAGGGAGGAGGAGGAGG + Intronic
914825000 1:151133540-151133562 GAGGCTCAGCCAAGGGGAGGCGG + Intronic
914848026 1:151293471-151293493 TAGGGGCAGGAATGGGGAGGAGG + Intronic
914942658 1:152036647-152036669 AAGGCCCAGGGCTGGGGAAGAGG - Intronic
915086554 1:153393179-153393201 CTGGATCAGGAATGGTGAGGAGG - Intergenic
915108046 1:153546532-153546554 AAGGCTCAGGGTCGGGGCGGGGG + Intronic
915126716 1:153670701-153670723 CGGGCCCAGGAGTGGGGAGGGGG - Intronic
915289057 1:154870572-154870594 CACGCTGGGCGATGGGGAGGAGG + Intergenic
915316161 1:155030236-155030258 AGGGCTCTGGGAAGGGGAGGTGG + Exonic
915323454 1:155068836-155068858 CAGACTCTGTGAGGGGGAGGGGG - Intronic
915389530 1:155528993-155529015 CAGGATCATGGATGGAGTGGAGG - Intronic
915632150 1:157160991-157161013 CAGGCTCAGGACTGGGGACAGGG - Intergenic
916750912 1:167722104-167722126 CGGGCTCAGGGACGCGGCGGCGG + Exonic
917077465 1:171220263-171220285 AAGCCTCGGGGGTGGGGAGGGGG + Intergenic
917511914 1:175675818-175675840 CATGTACAGGGGTGGGGAGGGGG + Intronic
917565326 1:176207040-176207062 GAGGCTGAGGGGAGGGGAGGCGG - Exonic
918226207 1:182485222-182485244 CAGGCTCGGGGAGTGGGTGGTGG + Intronic
919796474 1:201324235-201324257 CAGGATCAGGGCTGGGAAAGGGG + Intronic
919839689 1:201599748-201599770 CAGGCTCAGGGACAGGGGGAGGG + Intergenic
919854518 1:201696120-201696142 CAGACTCAGGGAGTGGGAGTGGG + Intronic
919902857 1:202056951-202056973 GAGGCCCAGGGCTGGGTAGGAGG - Intergenic
920071492 1:203305913-203305935 CGAGCACAGGGCTGGGGAGGAGG - Intronic
920111873 1:203592592-203592614 AAGGCTGGGGGATGGGGTGGGGG + Intergenic
921031603 1:211339526-211339548 CAGGCTCAGTTGTGGGGTGGGGG + Intronic
921292484 1:213671359-213671381 CAGGGGCTGGGGTGGGGAGGTGG + Intergenic
921593775 1:217033003-217033025 AAGGCTTATGGAAGGGGAGGGGG + Intronic
922590449 1:226771923-226771945 CGGGCTCAGGGATGTGCATGGGG - Intergenic
922706198 1:227791653-227791675 CAGGGTTAGGGTTGGGGCGGTGG - Intergenic
922900297 1:229131286-229131308 CAAGGGCAGAGATGGGGAGGAGG - Intergenic
923039323 1:230308589-230308611 CAGGGCTAGGGGTGGGGAGGCGG + Intergenic
923051821 1:230395212-230395234 GGAGCTCGGGGATGGGGAGGAGG - Intronic
923245404 1:232126307-232126329 CAGTCTCAGGGATTGCCAGGGGG + Intergenic
923458705 1:234188329-234188351 CAGACTCAGTGCTGGTGAGGTGG + Intronic
923684053 1:236142176-236142198 CGGCCCCTGGGATGGGGAGGGGG + Intergenic
923684085 1:236142252-236142274 CGGCCCCGGGGATGGGGAGGGGG + Intergenic
923755960 1:236791440-236791462 CAGGCACAGGGTGGGGGTGGGGG - Intergenic
923841543 1:237677532-237677554 CAGGATCTGGGATGAGGAGGAGG - Intronic
1062824572 10:558302-558324 CAGGGTCAGGAAGCGGGAGGTGG - Intronic
1062838621 10:652418-652440 CAGCCTGAGGGAAGGGGTGGAGG - Exonic
1062902232 10:1154970-1154992 CAGGGCCTGGGATGGGGATGAGG + Intergenic
1062972970 10:1662418-1662440 CAGGCTCTGGGTGGGGGAAGGGG - Intronic
1063064603 10:2595305-2595327 CAGGCTCAAGGATGAGCACGAGG + Intergenic
1064220514 10:13436754-13436776 CAGGGGTAGGGATGAGGAGGTGG - Intergenic
1064317153 10:14269115-14269137 AAGGCTGTGGGATGGGGTGGTGG + Intronic
1064553125 10:16521757-16521779 GAGGCTCAGAGCTGGGGCGGAGG + Exonic
1064697239 10:17980008-17980030 TTGGCTCAGGGAGGGAGAGGAGG + Intronic
1065371412 10:24990854-24990876 GAGGCTGAGGGGTGGGGGGGTGG + Intronic
1067534846 10:47101469-47101491 CAGGCCCAGGGAATGGGAAGTGG + Intergenic
1067836393 10:49644241-49644263 CAGGATCAGGGAGGGGCAGGAGG + Intronic
1069536406 10:69256885-69256907 CAGGGTTAGGGTTGTGGAGGTGG + Intronic
1069739293 10:70677370-70677392 AAAGCTCAGAAATGGGGAGGGGG - Intronic
1069778384 10:70939969-70939991 CAGTTTCAGGCATGAGGAGGGGG + Intergenic
1069952010 10:72025505-72025527 CAGGATCAGGGTTGCGAAGGAGG + Intergenic
1070442776 10:76463095-76463117 GAGGCTCAGGGATGGGTAGTGGG + Intronic
1070715805 10:78720125-78720147 CAGGCTCAGGGCTGGGGGCTGGG + Intergenic
1070745132 10:78929119-78929141 AAGGCTCAGGGAGGTCGAGGAGG - Intergenic
1070761210 10:79025411-79025433 AAGGCACAGGGTTGGGGGGGCGG + Intergenic
1070764471 10:79048523-79048545 CTGGCACTGGGGTGGGGAGGGGG + Intergenic
1070780182 10:79132981-79133003 CAGGCTCTGGGGTGGGGGAGGGG + Intronic
1071405111 10:85322517-85322539 CAAACTCAAGGATGGGGAGAGGG - Intergenic
1071491534 10:86139694-86139716 CTGGATCAGGGATGAGCAGGGGG + Intronic
1071629979 10:87211964-87211986 CTGGCTCTCTGATGGGGAGGAGG - Intergenic
1072246530 10:93548590-93548612 TAGGGTCAGGGTTGGGGAGAGGG - Intergenic
1072617547 10:97059709-97059731 CAGTCTGAGGGCTGGGCAGGAGG + Intronic
1073063480 10:100745505-100745527 CCGGCGCGGGGAGGGGGAGGAGG + Intronic
1073654085 10:105393549-105393571 CACGCTGAGGGATGAGGAAGGGG + Intergenic
1074427875 10:113368217-113368239 AAGGATGAGGGAAGGGGAGGGGG + Intergenic
1075227807 10:120645339-120645361 CAGGCTCAGGGATATAGGGGTGG - Intergenic
1075416814 10:122270391-122270413 CAAACTAGGGGATGGGGAGGTGG - Intergenic
1075419005 10:122287058-122287080 CAGGCTCAGGCTCAGGGAGGGGG - Intronic
1075512942 10:123086897-123086919 CAGGGTCACGGAGGTGGAGGTGG + Intergenic
1075723248 10:124599223-124599245 CATGCACAGGGATGGACAGGAGG - Intronic
1075742194 10:124702696-124702718 GAGGCTCAAGGACAGGGAGGAGG + Intronic
1075778264 10:125001740-125001762 CAGGAGCAGGGCTGGGGAGCCGG - Intronic
1075791027 10:125084559-125084581 GAACCTCAGGGCTGGGGAGGTGG - Intronic
1075939355 10:126375983-126376005 GAGGCTGGGGGGTGGGGAGGGGG - Intronic
1076236750 10:128869335-128869357 GGGGCTTAGGGGTGGGGAGGGGG + Intergenic
1076367054 10:129927868-129927890 AGGACACAGGGATGGGGAGGTGG + Intronic
1076402085 10:130190963-130190985 CCGGCCCAGGCTTGGGGAGGCGG - Intergenic
1076472356 10:130727950-130727972 CAGGCCCAGGGATAGAGAAGAGG + Intergenic
1076609324 10:131711325-131711347 GAGGCTCAGGGAGGAGGAGCGGG - Intergenic
1076867561 10:133175509-133175531 CAGGCACATGGATGGGTGGGTGG + Intronic
1077086661 11:755909-755931 CAGGATCAGGGACGGGTTGGTGG - Exonic
1077245399 11:1534596-1534618 CAGGCTCTGTGCTGGGGCGGAGG - Intergenic
1077319355 11:1934288-1934310 GATGCTCAGGGATGGAGAGAGGG - Intronic
1077376049 11:2205526-2205548 GAGGCTGAGAGGTGGGGAGGTGG - Intergenic
1077377236 11:2210787-2210809 CAGGTCCAGGGATGTGGTGGAGG + Intergenic
1077480780 11:2813471-2813493 CAGGCGCAGGGTTGAGGAAGGGG - Intronic
1077491762 11:2864245-2864267 CAGGCTCAGTGATGTGGAGCTGG - Intergenic
1077915443 11:6608793-6608815 CAAGCTAGGGGATGGGGAGATGG - Intronic
1078057702 11:8020450-8020472 GAGACTCAGGGAAGGTGAGGAGG - Intronic
1078148447 11:8738593-8738615 TAGCAGCAGGGATGGGGAGGAGG - Intronic
1078511420 11:11987095-11987117 CAGACACAGGGATACGGAGGTGG + Intronic
1078794633 11:14579906-14579928 CAGGCTGATGGATGGGTAAGAGG + Intronic
1079083666 11:17430619-17430641 CTTGCTCAGGGATGGCGAGCTGG + Intronic
1079122861 11:17697405-17697427 CAGGCTTGGGGATGGAAAGGGGG + Intergenic
1079281578 11:19091435-19091457 CAGCCTCAGGGACCCGGAGGTGG - Intergenic
1079496012 11:21044864-21044886 TAGTCTCAGAGATGGGGAAGAGG + Intronic
1079668929 11:23141890-23141912 CAGGCTCAGGGTGGTGGTGGGGG - Intergenic
1079672706 11:23188358-23188380 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
1080245251 11:30172866-30172888 CAGGCTCAGAAATGGGCTGGTGG - Intergenic
1081729630 11:45361161-45361183 CAGGCCCAGGGATTAGGATGGGG + Intergenic
1081773672 11:45664404-45664426 CAGGCCCGGGGTGGGGGAGGGGG + Intronic
1081805057 11:45885873-45885895 CAGCCCCAGGAACGGGGAGGCGG - Exonic
1081872122 11:46387985-46388007 CAGGCTCAGGGAAGGGCCTGTGG - Intergenic
1082028255 11:47587871-47587893 TAAGCTCAGGGTTGGGAAGGGGG + Intronic
1082787467 11:57324782-57324804 CGGGGTCCGGGATGGGGCGGGGG - Intronic
1082874399 11:57973103-57973125 CAGCGTCAGGGCTGGGGTGGAGG - Intergenic
1083149228 11:60781448-60781470 CAGGCTCAGAGCTGGGGACGTGG - Intergenic
1083491316 11:63016811-63016833 CTGGCTGGGGGATGGTGAGGAGG - Intergenic
1083595803 11:63917768-63917790 AGGGCTGAGGGATGGGGAGTGGG + Intergenic
1083616939 11:64030959-64030981 CAGGCTCTGGGCTGATGAGGAGG + Intronic
1083682247 11:64357069-64357091 CTGGCTGAGGGATGGGGTGAGGG - Exonic
1083844025 11:65320820-65320842 CTGGCTGAGGGTTGGAGAGGAGG + Exonic
1083869226 11:65476995-65477017 CAGGCCCAGGCCTGGGCAGGTGG + Intergenic
1083944401 11:65915997-65916019 CAGGCACGGGGCTGGAGAGGTGG + Intergenic
1084009879 11:66341478-66341500 GAGGATCTGGGATGAGGAGGTGG - Intronic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084484337 11:69439122-69439144 TAGGTTCAGGGATGCAGAGGTGG - Intergenic
1084569174 11:69949268-69949290 AGGGCACAGGGCTGGGGAGGAGG + Intergenic
1084722545 11:70916653-70916675 CAGGCGAAGGGAGGGCGAGGGGG - Intronic
1084934705 11:72580721-72580743 CTGGCTCTGAGATAGGGAGGAGG - Intronic
1085044067 11:73343269-73343291 GAGGCCCAGGTACGGGGAGGGGG + Intronic
1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG + Intronic
1085313107 11:75527619-75527641 CAGGCCCAGGGGTTGGGAGTAGG + Intergenic
1085360310 11:75878887-75878909 CAGGGACAGGGACAGGGAGGGGG + Intronic
1085360314 11:75878893-75878915 CAGGGACAGGGAGGGGGAGGGGG + Intronic
1085396606 11:76209889-76209911 CAGGCTGGGGGCTAGGGAGGAGG - Intronic
1086133011 11:83420370-83420392 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
1087158928 11:94930331-94930353 CAGGCTGATAGATGGGGAGGTGG + Intergenic
1087196421 11:95308541-95308563 CAGGGGCTGGGGTGGGGAGGGGG - Intergenic
1087293302 11:96341916-96341938 CTGCCTCTGGGATGGTGAGGTGG + Exonic
1087818244 11:102682577-102682599 CAGGATGAGGGATGGAGGGGTGG - Intronic
1088392601 11:109331340-109331362 CAGGGACAGTGATGGAGAGGAGG + Intergenic
1088733387 11:112704273-112704295 CATGCTCAGGGATTGGAAGAAGG + Intergenic
1088770987 11:113036138-113036160 CAGGCTCAGGGCTGGGGGCTTGG - Intronic
1088895763 11:114077216-114077238 CAGGCTGCAGGCTGGGGAGGGGG - Intronic
1089165295 11:116471314-116471336 CAGCCTAGGAGATGGGGAGGAGG + Intergenic
1089256695 11:117197999-117198021 CAGGGTCAGGGATGGAGGAGTGG + Intergenic
1089396731 11:118141046-118141068 GGGGCTGAGAGATGGGGAGGGGG + Intronic
1089533264 11:119145509-119145531 CCGTCTCAGGGAATGGGAGGAGG + Intergenic
1089653819 11:119932867-119932889 CAGGGTGAGGGATGGGGCAGGGG - Intergenic
1089866954 11:121640806-121640828 GAGGCTTTGGGATGGGGAGAAGG + Intergenic
1090276518 11:125423777-125423799 CAGGGATGGGGATGGGGAGGAGG + Intronic
1090546626 11:127773521-127773543 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
1090621478 11:128564589-128564611 CAGGCTGAAGGACGGGGAGGGGG + Intronic
1090909550 11:131106473-131106495 CAGACTGATGGATGGAGAGGTGG - Intergenic
1091216443 11:133905235-133905257 CAGGCTTGGGGGTGGGGTGGGGG - Intergenic
1091442315 12:521143-521165 TAGACTCAGGGGTGGGGAGAGGG - Intronic
1091639031 12:2220368-2220390 AAGGCTCAGGCATGGGGAACTGG + Intronic
1091723652 12:2830955-2830977 AAGGCTCAGGGCTGGGGGGGTGG - Intronic
1091885544 12:4014692-4014714 CAGAGTTAGTGATGGGGAGGTGG + Intergenic
1092000009 12:5024111-5024133 CCCTCTCTGGGATGGGGAGGTGG + Intergenic
1092057556 12:5520569-5520591 CAGGCACAGGGATGTGCAGCTGG + Intronic
1092488272 12:8921704-8921726 CTGGTTGAGGGGTGGGGAGGTGG - Exonic
1092547916 12:9467645-9467667 CTTGCTGAGGGAAGGGGAGGAGG + Intergenic
1092877220 12:12858787-12858809 GAGGCAAAGGGATGGGGAGGAGG - Intergenic
1094029397 12:25993530-25993552 CAGGCCCAAGGATGGGAATGAGG + Intronic
1094375254 12:29783128-29783150 CAGGCGAAGGGGTGCGGAGGCGG + Intronic
1095206305 12:39443429-39443451 CAGGCTGGGGGAGGGCGAGGTGG - Intergenic
1096183356 12:49563413-49563435 AAGGCTGAGGGCTGGGAAGGTGG - Intronic
1096184219 12:49567795-49567817 CAGGCTGGTGGCTGGGGAGGTGG + Intronic
1096492364 12:52019652-52019674 CAGGCTCGGGGGTGGGCAGTGGG + Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096538318 12:52289262-52289284 CTGTCTCAGGTATGAGGAGGAGG - Exonic
1096540459 12:52304102-52304124 CTGTCTCAGGTATGAGGAGGAGG + Exonic
1096541995 12:52313236-52313258 GAGACTCAGGAATTGGGAGGTGG + Intergenic
1096578541 12:52569797-52569819 CAGGCTCTGGGATGAGGAAATGG - Intronic
1096870353 12:54588696-54588718 CGGGCTGGGGGAGGGGGAGGGGG - Intergenic
1096946589 12:55414305-55414327 CTGGTTGAGGGGTGGGGAGGTGG + Intergenic
1097056348 12:56252124-56252146 CAGGCTCAGGGAGGTGAATGGGG + Intronic
1097187594 12:57204036-57204058 CAGGCACAGGGATGGGAACCCGG + Intronic
1097810243 12:64011120-64011142 CAGGCTGAAGGATGGGGTGTGGG + Intronic
1098572648 12:72006377-72006399 AAGGAACAGGGTTGGGGAGGTGG + Intronic
1100433935 12:94554480-94554502 CGAGCTCAGGCATGGGGAGGAGG + Intergenic
1100446069 12:94661155-94661177 CAGGCTCTAGGAACGGGAGGGGG + Intergenic
1101230494 12:102736477-102736499 CAGCCTCACCAATGGGGAGGGGG - Intergenic
1101431526 12:104631501-104631523 CATGCCCAGAGATGGGAAGGAGG + Intronic
1101504413 12:105332395-105332417 CAGTTTTAGGGATGGGGAGGGGG + Intronic
1101555539 12:105805580-105805602 CAATCCCAGGGATGGGGAGATGG - Intergenic
1102167273 12:110816624-110816646 CAGTGACTGGGATGGGGAGGTGG + Intergenic
1102167860 12:110820762-110820784 CAGGGGGAGGGAAGGGGAGGGGG - Intergenic
1102243769 12:111342104-111342126 CAGGCCCTGGGATGGGGAAGGGG - Intronic
1102277741 12:111597138-111597160 CAGACTCAGAGAAGGGGAAGGGG + Intronic
1102592850 12:113969995-113970017 CAGGCTCAGGGAATGGGAGATGG + Intergenic
1102625011 12:114227908-114227930 GAGGGTGAAGGATGGGGAGGAGG + Intergenic
1102627555 12:114247523-114247545 CAGGTTCAGGGCTGGGGATGGGG + Intergenic
1102975774 12:117206261-117206283 GAGGCTCAGGGATGGGATGGAGG + Intergenic
1103053769 12:117802661-117802683 AAGTGTCAGGGGTGGGGAGGGGG + Intronic
1103446319 12:120997377-120997399 CGGGCTCTGGGAAGGAGAGGTGG + Intronic
1103623186 12:122201019-122201041 CAGGTCACGGGATGGGGAGGAGG + Intronic
1104015696 12:124960246-124960268 CTGCCTCAGGGAAAGGGAGGTGG + Intronic
1104844704 12:131840931-131840953 CAGCCGCAGGGTTGGGGATGGGG - Intronic
1105213437 13:18271233-18271255 CAGGCTCTAGGCTGGGGTGGGGG - Intergenic
1106920148 13:34554381-34554403 AAGGCTCAGGGATGAAGTGGTGG - Intergenic
1107520126 13:41171971-41171993 CCGTCTCAGGGAGGGGGAGAGGG + Intergenic
1108156387 13:47589698-47589720 CAGGAAAAGGGATGGGGAGTTGG + Intergenic
1108512852 13:51171144-51171166 CAGGCTAAGGGAGGAGAAGGAGG - Intergenic
1108673233 13:52712627-52712649 CATGCTCAGGCCTGTGGAGGGGG + Intronic
1108750131 13:53439885-53439907 GAGGGGGAGGGATGGGGAGGGGG - Intergenic
1108954246 13:56132507-56132529 GAGGCTGAGGGAGGGGGTGGTGG + Intergenic
1110881513 13:80577937-80577959 CAGACTCAGGGCTGTTGAGGGGG + Intergenic
1111127528 13:83930714-83930736 CAGGCTGGGGGATGGGGAGCGGG - Intergenic
1111630312 13:90840737-90840759 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
1112157691 13:96835289-96835311 ATGGCTCAGTGATGTGGAGGGGG - Exonic
1112796076 13:103058006-103058028 CAGACTGAGGGCTGGGGAGGGGG + Intronic
1113385290 13:109842788-109842810 CAGGCCCAGGAGTGGGGATGGGG - Intergenic
1113385793 13:109846710-109846732 GAGGACCAGGGATGGGGTGGAGG + Intergenic
1113400270 13:109985983-109986005 CAGGGTCAGGCAGTGGGAGGAGG - Intergenic
1113823327 13:113231265-113231287 CCATCTCTGGGATGGGGAGGAGG + Intronic
1114648618 14:24269463-24269485 CAGGGTCAGGGATGCTCAGGAGG - Intronic
1115310624 14:31974835-31974857 CAAGCTCAGGGATGGAGGTGGGG - Intergenic
1116534917 14:46016838-46016860 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
1117546375 14:56797673-56797695 CAGGCTCTGGAATGGGGAAGCGG - Intergenic
1118327355 14:64790704-64790726 CAGGCACAGGTGTGGGGAAGGGG + Intronic
1118702228 14:68444745-68444767 TAGGAGCAGGGATGGGGTGGAGG + Intronic
1119022282 14:71125571-71125593 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
1119296574 14:73537903-73537925 CAGGAACAGGGATGGGCAGAGGG - Intronic
1119645669 14:76346618-76346640 CTGCCTGAGGGATGGGAAGGAGG - Intronic
1120268314 14:82278365-82278387 CAGGATCAAGGGTGGGGTGGAGG - Intergenic
1120371294 14:83639644-83639666 CTGGCTCGGGGGTGGGGAGCGGG + Intergenic
1120618118 14:86732601-86732623 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
1120765846 14:88325943-88325965 GAGGGTTGGGGATGGGGAGGTGG + Intronic
1120883012 14:89429093-89429115 GAGGCACAGAGATGGGGAAGAGG + Intronic
1121266699 14:92608000-92608022 CAGGGCTAGTGATGGGGAGGGGG + Intronic
1121269903 14:92631179-92631201 GAGGCTCTGGGAAGGGGAAGGGG - Intronic
1121529275 14:94641128-94641150 GAAGCTGAGGGGTGGGGAGGAGG + Intergenic
1121539006 14:94711225-94711247 CAGGCGGAGGGGTGGAGAGGGGG - Intergenic
1121544996 14:94756647-94756669 CAGGGTGTGGGGTGGGGAGGCGG - Intergenic
1121572371 14:94956622-94956644 CAGGCACCTGGTTGGGGAGGGGG + Intergenic
1121586566 14:95067087-95067109 CAGGAGCTGAGATGGGGAGGAGG - Intergenic
1121599738 14:95194451-95194473 AAAGCTCTGGGCTGGGGAGGAGG + Intronic
1121970231 14:98349234-98349256 GCTGCTCAGGGAAGGGGAGGGGG - Intergenic
1122081571 14:99270896-99270918 CCGGCTCCGGGCCGGGGAGGGGG - Intronic
1122135491 14:99630472-99630494 GAGGCTCAGGGATGCTGAGCTGG - Intergenic
1122293724 14:100693539-100693561 CAGACTCAGGCAGGGGCAGGTGG - Intergenic
1122314315 14:100816770-100816792 AAGGTCCAGGGCTGGGGAGGTGG - Intergenic
1122349269 14:101078129-101078151 CCGGCTCAGGCCTGGGGGGGGGG + Intergenic
1122353270 14:101109654-101109676 GAGGATCAGGGAAGGGGACGAGG + Intergenic
1122387168 14:101357025-101357047 CAGGGGCTGGGATGGGGATGGGG + Intergenic
1122457099 14:101862929-101862951 GAGGCTGAGGCAGGGGGAGGGGG - Intronic
1122601433 14:102923699-102923721 CTGGGTCAGTGCTGGGGAGGAGG - Exonic
1122674804 14:103403040-103403062 GAGGGGCAGGGATGGGGTGGGGG - Intronic
1122694217 14:103545042-103545064 CAGGCCCAGCGGTGGGGAGTAGG - Intergenic
1122715400 14:103693855-103693877 CTGGCTCAGGGAGGCCGAGGTGG + Intergenic
1122954721 14:105065312-105065334 CAGGCTCTGGGATGGGGCTGGGG - Intronic
1122987778 14:105220520-105220542 TGGGCTCAGTGATGGGGAGCTGG - Intronic
1202918067 14_KI270723v1_random:3295-3317 CAGGGGCAGGGCAGGGGAGGAGG - Intergenic
1202926558 14_KI270724v1_random:31291-31313 CAGGGGCAGGGCAGGGGAGGAGG + Intergenic
1123409765 15:20048505-20048527 CAGTCCCAGGGAGGGGCAGGAGG + Intergenic
1123448444 15:20345673-20345695 CAGACTCTGGGATGGGGGTGGGG + Intergenic
1123519097 15:21055213-21055235 CAGTCCCAGGGAGGGGCAGGAGG + Intergenic
1123632586 15:22272492-22272514 CAGGCTCGGGGATGCGGTGGAGG + Intergenic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1124221548 15:27854088-27854110 CAGAATCTGGGGTGGGGAGGAGG - Intronic
1124634294 15:31355056-31355078 GAGGCTGAGGGATGGCGAGATGG - Intronic
1124721410 15:32114397-32114419 CTGGGTCAGGCATGTGGAGGTGG - Intronic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1125508551 15:40281156-40281178 GAGCCTGAGGGCTGGGGAGGGGG + Intronic
1125677248 15:41509001-41509023 CAGGCTCAGAGGTGGGGTTGGGG + Intronic
1126856908 15:52847637-52847659 GAGCCACAGGGATGGGGATGTGG + Intergenic
1127599258 15:60518784-60518806 CAGGGTCAGTGAAGGGGAGAGGG - Intronic
1127612239 15:60648072-60648094 CAGACTGAGGGAGGAGGAGGAGG + Intronic
1128154162 15:65382274-65382296 CTGGCTGAAGGAGGGGGAGGAGG + Exonic
1128328028 15:66737750-66737772 CAGCTTCAGGCCTGGGGAGGTGG + Intronic
1128467419 15:67924598-67924620 GAGGCCCAGGGTTGAGGAGGAGG - Intergenic
1128529452 15:68433741-68433763 CAGGGTCAGGGTAGGGAAGGAGG + Intergenic
1128561099 15:68668264-68668286 ATGGCCCAGGGCTGGGGAGGGGG + Intronic
1128778545 15:70342413-70342435 TAGGCTCAGAGATTGGGTGGAGG + Intergenic
1129208304 15:74050486-74050508 CAAGCACAGGGATGAGAAGGTGG - Intergenic
1129652089 15:77498206-77498228 CAGGCTCAGGGCTGAGGATCCGG - Intergenic
1130032567 15:80328905-80328927 GGGGTTCAGGGATGGGGATGGGG + Intergenic
1130032569 15:80328911-80328933 CAGGGATGGGGATGGGGAGGTGG + Intergenic
1130049077 15:80468271-80468293 GAGGTTCAGGGTTGGGGAGGAGG - Intronic
1130121003 15:81047543-81047565 GTGGCTCAGGGATGGGGTGGTGG + Intronic
1130146712 15:81280110-81280132 GAGGCCCAGGGAAGGGAAGGTGG - Intronic
1130553971 15:84910014-84910036 CAGGGTCAGGGGTAGGCAGGAGG - Intronic
1130657063 15:85799131-85799153 CAGGGTCAGGAACAGGGAGGTGG - Intergenic
1130908838 15:88257308-88257330 CAGGCTCACGGACGGCGACGGGG + Intergenic
1131264295 15:90906560-90906582 AAGGCACAGGGATCGGCAGGGGG + Intronic
1131269045 15:90935435-90935457 GAGCCTCATGGATGGGGAGAAGG - Intronic
1131324664 15:91430680-91430702 CAGACTCAGGGAGTGGGAGAGGG + Intergenic
1132156020 15:99495634-99495656 CAGGGACAGAGATGGAGAGGGGG + Intergenic
1132385550 15:101397736-101397758 AAGGCTGAGGAAGGGGGAGGAGG - Intronic
1132481502 16:168547-168569 CTGGCACAGGAAAGGGGAGGAGG - Intergenic
1132605146 16:790522-790544 CAGTCTCAGGTCGGGGGAGGAGG + Exonic
1132645311 16:996810-996832 CAGGGTCAGGGCTGGGGCGGGGG + Intergenic
1132664702 16:1076133-1076155 GAGGGAGAGGGATGGGGAGGCGG - Intergenic
1132709114 16:1258721-1258743 GGGGCTCAGGGTGGGGGAGGGGG - Exonic
1132709175 16:1258887-1258909 CGGATTCAGGGTTGGGGAGGAGG - Exonic
1132852250 16:2030067-2030089 GAGGCTGGGGGCTGGGGAGGCGG - Intronic
1132931792 16:2462432-2462454 CAGGCTCAGTGCTGTGGAGGTGG + Exonic
1132976095 16:2711881-2711903 GAGACTGAGGGATGGGGCGGAGG + Intergenic
1132976332 16:2712909-2712931 GAGGCTCTGGGATGGAGAGAAGG - Intronic
1133046798 16:3092595-3092617 GCCGCTCAGGGATGGGGAGGAGG - Exonic
1133227019 16:4345828-4345850 GAGGCTCAGGGATGGGATGCTGG + Intronic
1133229806 16:4361133-4361155 CAGGCTCAGGAATGGGGCTGGGG - Intronic
1133284332 16:4683623-4683645 CATGCTGGGGGATGGGAAGGAGG + Intronic
1133347615 16:5081072-5081094 GAGGCTCAGGGAGGAGGCGGGGG + Intronic
1133414535 16:5596080-5596102 CAGGCTCAGGGATGTGGAGAGGG + Intergenic
1134047337 16:11110338-11110360 CAGGCACTGGGATGGGGCTGGGG + Intronic
1134314893 16:13109419-13109441 CATGCTCAGGGATGGGCTGGTGG + Intronic
1134817537 16:17218322-17218344 CAAACTCAGGGGTGGGGAGAGGG + Intronic
1135157080 16:20061743-20061765 TAGGGTCAGGCGTGGGGAGGAGG - Intronic
1135991045 16:27219002-27219024 CAGCCTGGGCGATGGGGAGGAGG + Exonic
1136248014 16:28986174-28986196 CTGGCTCAGGGGTGGGTAGGAGG - Exonic
1136296856 16:29308838-29308860 CAGGCAGAGGGATGGGCAGAGGG - Intergenic
1136343960 16:29663432-29663454 CAGGGTCAGGGAAGGCCAGGAGG + Intronic
1136400054 16:30011991-30012013 CAGGCGCAGGGCCGGGCAGGGGG - Intronic
1136428595 16:30184606-30184628 GAGGCAGAGGTATGGGGAGGAGG + Intronic
1136551902 16:30986347-30986369 CTGGACCTGGGATGGGGAGGAGG + Intronic
1137000132 16:35222123-35222145 CAGGGGCAGGAAAGGGGAGGAGG - Intergenic
1137026952 16:35486303-35486325 CAGGGCCAGGGTAGGGGAGGAGG - Intergenic
1137369003 16:47887347-47887369 CAGGGTCAGGGAGGGGGCTGCGG - Intergenic
1137580279 16:49629574-49629596 TAAGTTCAGGGATGTGGAGGGGG - Intronic
1137592663 16:49703375-49703397 TAGAGTCAGGGATGGGGTGGGGG + Intronic
1137608612 16:49803890-49803912 CAGACTCAGGGGTGGGGAACCGG + Intronic
1138118909 16:54382446-54382468 CAGGCTCTGGGCTGGAGAGGTGG - Intergenic
1138210432 16:55158539-55158561 CAGGCTCAGGGATTAGGATATGG + Intergenic
1138360581 16:56424886-56424908 GAGGCGCGGGGAGGGGGAGGGGG - Intronic
1138375825 16:56563369-56563391 CAGGCACTGGGGAGGGGAGGAGG - Intergenic
1138581159 16:57941266-57941288 GAGTCTGAGGGGTGGGGAGGGGG - Intronic
1139261476 16:65598697-65598719 CAGGCCTAGGGTTGGGGTGGGGG + Intergenic
1139406884 16:66726187-66726209 CTGTCTCATGGACGGGGAGGTGG - Intronic
1139553929 16:67694071-67694093 CAGCCTCAGAGCTCGGGAGGTGG - Intronic
1139671001 16:68492527-68492549 CAGCCACAGGGTTGGGGTGGGGG + Intergenic
1139698403 16:68691939-68691961 CATCCTCAGGGAGGGGGTGGGGG - Intronic
1139698946 16:68695397-68695419 GGGGCTCTGGGATTGGGAGGTGG + Intronic
1139984245 16:70884283-70884305 GAGGGCCAGGGATGGGAAGGGGG + Intronic
1140265742 16:73418933-73418955 CAGGATCTGGAATTGGGAGGTGG - Intergenic
1140619784 16:76716361-76716383 CAGGCTCAGGGCTGCTGTGGAGG + Intergenic
1140790496 16:78386626-78386648 CAGGCTGGGGGGTGGGGCGGGGG - Intronic
1140877850 16:79169559-79169581 CAGAATCAAGGATGGGGAAGAGG + Intronic
1140902964 16:79386720-79386742 CAGACTCAGTGATGGGGTCGTGG + Intergenic
1141430778 16:83969224-83969246 CAGGATCCGGGATGGAGAGGAGG - Intronic
1141523868 16:84598887-84598909 CAGTCAAAGGGATGGGGATGTGG + Intronic
1141536406 16:84684041-84684063 TAGTCTCAGCTATGGGGAGGAGG + Intergenic
1141640387 16:85337639-85337661 CTGGCGCAGGGATGGGCTGGGGG + Intergenic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1142177954 16:88653514-88653536 AGGGCTCAGGGAGGGGGAGACGG + Intronic
1142240784 16:88943932-88943954 CACACTCAGGGCTCGGGAGGGGG + Intronic
1142262825 16:89050712-89050734 CAGGCTCAGGGGTGGGGGGCGGG - Intergenic
1142363266 16:89637145-89637167 CAGGGTCGGGGCTGCGGAGGTGG - Intronic
1142395225 16:89828259-89828281 GGGGCTCAGGGCTGGGGACGCGG - Intronic
1142524308 17:528253-528275 AAGGCTGAGGGAGGGGGAGATGG - Intronic
1142594439 17:1022691-1022713 CAGGGTGAGGGCTGGAGAGGCGG - Intronic
1142688851 17:1592839-1592861 CAGGCTGGGGGTTGGGGAGCAGG + Intronic
1142767002 17:2070460-2070482 CAGGCACAGGGCTGGGGAAGTGG + Intronic
1142943348 17:3402372-3402394 GAGGCTCAGGGATGGGTAGAAGG - Intergenic
1143129157 17:4665243-4665265 CAAGGGCAGGGATGGGGAGGTGG - Intergenic
1143376601 17:6471046-6471068 CAGGCCCTGGGATAGGGAGAAGG - Intronic
1143402407 17:6655079-6655101 CTGGCTCCGGAATGGCGAGGGGG + Intergenic
1143512900 17:7405671-7405693 CAGGCGCAGGGAGGGAGATGGGG - Intronic
1143583225 17:7838389-7838411 GGGACTCAGGGACGGGGAGGAGG + Intergenic
1143724985 17:8838642-8838664 CTGGCCCAGGCATGTGGAGGTGG - Exonic
1143977987 17:10844428-10844450 CAGCCCCAGGGTTGGGGTGGAGG + Intergenic
1143993828 17:10989708-10989730 TAGGTTCAGGGGTGGGTAGGGGG + Intergenic
1144164614 17:12597328-12597350 AAGTCTCAAGGATGGAGAGGAGG - Intergenic
1144338719 17:14296029-14296051 ATGGCTCAGGGATGAGGAGATGG + Intergenic
1144499573 17:15773432-15773454 CAGGCTCTGGGAGGCCGAGGCGG - Intergenic
1144590682 17:16521069-16521091 GAGGCAGAGGGATGGGGTGGAGG + Intergenic
1144684056 17:17214772-17214794 CCGGCTCCTGCATGGGGAGGTGG - Intronic
1144754277 17:17669814-17669836 CAGGCTGTGGGATGGGGGTGGGG - Intergenic
1144846840 17:18224684-18224706 CTGGCTCAGGGCTGGGGCTGCGG - Intergenic
1145080809 17:19892887-19892909 CAGGCTAAGGGAGGAGAAGGGGG + Intergenic
1145190968 17:20842072-20842094 CAAGCGCAGGGCTGGGGACGTGG - Intronic
1145268222 17:21390552-21390574 GGGGCACAGGGATGGGGAGGGGG + Intronic
1145902114 17:28496067-28496089 CAGGGACTGGGGTGGGGAGGTGG - Intronic
1146125679 17:30229388-30229410 ACGGCTTAGGGGTGGGGAGGGGG + Intronic
1146466489 17:33090591-33090613 GGGGGTCAGGGATGGAGAGGGGG + Intronic
1146635876 17:34504089-34504111 CAGGGGCAGGGATGGGGGTGGGG - Intergenic
1146720598 17:35120902-35120924 CAGCTTCAGGGGTGGGGAGGGGG - Intronic
1146728023 17:35171295-35171317 AAGGCACAGGGTTGGGGAGAGGG - Intronic
1147050074 17:37787596-37787618 CAGGCTGAGGGATGTGGCAGAGG - Intergenic
1147123753 17:38352064-38352086 CGAGCTCCGGGATGGCGAGGCGG + Intergenic
1147155697 17:38543630-38543652 AAAGCTCCGGGATCGGGAGGAGG + Intronic
1147387498 17:40090928-40090950 CAGCCACAGGGAGGGGGAGGAGG - Intronic
1147464778 17:40602717-40602739 CATGCTCAGGGAGGAGGATGGGG - Intergenic
1147599787 17:41738677-41738699 CAGGGTCAGGCCAGGGGAGGGGG - Intergenic
1148071959 17:44913874-44913896 AAGGCTGAGGAATGGGGAGAAGG - Intronic
1148150975 17:45396310-45396332 CGGGTTCAGGGATGGGGATAGGG + Intronic
1148202235 17:45756796-45756818 GAGGGACAGGGATGGGGAGAGGG + Intergenic
1148216905 17:45838240-45838262 CACACTAAGGGACGGGGAGGGGG - Intergenic
1148664730 17:49365824-49365846 CTGTCTGAGGGATGGGGATGAGG + Intergenic
1148860175 17:50600519-50600541 GGTCCTCAGGGATGGGGAGGGGG + Intronic
1148861377 17:50606032-50606054 CAGGCTCAGAGGTGGGGCTGTGG + Intronic
1148866809 17:50633045-50633067 CAGGGTCATGGAAGGGGTGGAGG + Intergenic
1148955676 17:51351793-51351815 AAGGGGCAGGGAAGGGGAGGAGG - Intergenic
1149035948 17:52134832-52134854 CTGGCTCATGCATGGGGTGGAGG - Intronic
1149300950 17:55304300-55304322 CCGGCCCAGGGAGGAGGAGGTGG + Intronic
1149627329 17:58089007-58089029 GAGGCTGAGGGATGGGGTGGGGG + Intronic
1149863886 17:60139740-60139762 TGGGGTCAGGGATGAGGAGGAGG - Intergenic
1150219017 17:63485380-63485402 CAGGTTTGGGGGTGGGGAGGTGG - Intronic
1150322829 17:64230695-64230717 CAGGCTCAGGGAGGTGAAGTGGG - Intronic
1150636683 17:66918185-66918207 CAGGCTCTGGGAGGCCGAGGCGG - Intergenic
1151267811 17:72970006-72970028 CTCGCTCAGGTATGTGGAGGTGG - Intronic
1151322442 17:73360005-73360027 CAGGCTGAGAGGTGGGGAGGTGG - Intronic
1151361712 17:73593107-73593129 CAGGAGCTGGGGTGGGGAGGAGG - Intronic
1151547709 17:74803380-74803402 CCAGCTCAGGGATGTGGATGGGG - Intronic
1151551880 17:74826957-74826979 GGGGGTCAGGGATGGGGAGGAGG - Intronic
1151829800 17:76542873-76542895 TAGGCTTGGGGATGGCGAGGTGG + Intronic
1151944313 17:77311226-77311248 GAGGCTCTGGGGTGGGGTGGGGG - Intronic
1152019492 17:77772959-77772981 CAGACTCTGGGTTGGGCAGGGGG - Intergenic
1152068563 17:78124364-78124386 CAGGGTCATTGAGGGGGAGGCGG + Intronic
1152340345 17:79720909-79720931 CAGACTCTGGGATGGGGGTGGGG - Intergenic
1152482623 17:80565373-80565395 AAGGCAAAGGGAAGGGGAGGTGG + Intronic
1152556457 17:81055471-81055493 CGGGCCCAGGGATGTAGAGGAGG - Intronic
1152794313 17:82299363-82299385 CAGGCTCAGTGTTGGAGATGGGG - Intergenic
1152800239 17:82327434-82327456 CAGGCACAGGGAAGGGAAGGAGG - Intronic
1152804663 17:82349601-82349623 GAGGCTCAGGAATGAGGGGGAGG - Intergenic
1153197680 18:2618784-2618806 CAGAGGCAGGGATGGGTAGGGGG + Intergenic
1153345417 18:4020431-4020453 CAGGTCCTGGGCTGGGGAGGAGG + Intronic
1153514250 18:5890528-5890550 CAGCCGCAGGGGTGGCGAGGGGG + Exonic
1154000946 18:10482034-10482056 AAGGCTCGGGGGAGGGGAGGGGG - Intronic
1154122605 18:11663927-11663949 CAGGCTGTGGTATGGGGACGAGG + Intergenic
1154207000 18:12346061-12346083 GAGGCACAGGGATGTGGAGGAGG - Intronic
1155086419 18:22463567-22463589 CATGGGCAGGGATTGGGAGGTGG - Intergenic
1155341418 18:24818014-24818036 CAGTTTCAGGCATGGGGACGAGG + Intergenic
1155886717 18:31217375-31217397 CACGATGGGGGATGGGGAGGTGG - Intergenic
1155972225 18:32092898-32092920 CCGGCTCCGCGAGGGGGAGGGGG - Intronic
1156234740 18:35191438-35191460 CAGCCTCTGGGAAGGGGAAGTGG + Intergenic
1156462100 18:37326826-37326848 GTGGCAGAGGGATGGGGAGGGGG - Intronic
1156718826 18:40045337-40045359 CCGGGACAGGGGTGGGGAGGGGG - Intergenic
1157474291 18:48011503-48011525 CTGGCTCAGGGAGGAGGTGGTGG + Intergenic
1157544679 18:48539448-48539470 CAGGAGCAGGGATGGGGGGAAGG - Intronic
1157556299 18:48615267-48615289 CAGGCTGAGAGCTGTGGAGGTGG + Intronic
1157596373 18:48866430-48866452 GTGACTCAGGGCTGGGGAGGGGG + Intergenic
1157728456 18:49983552-49983574 CAGGGGCCGGGATGGGGTGGTGG - Intronic
1157776784 18:50402256-50402278 CGGGGTAAGGGATGGGGATGAGG - Intergenic
1158648928 18:59269549-59269571 CCGGCTCAGGGTTGGGGACGCGG - Intronic
1158806772 18:60983242-60983264 GAGGGACAGGGATGGGGAGAAGG + Intergenic
1158871453 18:61692250-61692272 GAGGGTGGGGGATGGGGAGGGGG + Intergenic
1160007906 18:75081781-75081803 CAGTCTCAGGGGTGGGGACGGGG - Intergenic
1160325328 18:77941686-77941708 GAGGGTGAGGGGTGGGGAGGTGG - Intergenic
1160555730 18:79723776-79723798 AAGGGTCAGGGAAGGGGAAGCGG - Intronic
1160691293 19:461574-461596 CCGGCTCGGGGGTGGGGGGGGGG + Intergenic
1160744284 19:703575-703597 ATGGCTCAGGGTTGGGGTGGGGG + Intergenic
1160842266 19:1151379-1151401 CAGGCTAGGGGATGGGACGGGGG + Intronic
1160919198 19:1511969-1511991 CTGGAGCAGGGAAGGGGAGGAGG + Intronic
1160976783 19:1796678-1796700 CGGCCTCAGAGATGGGGAGGTGG + Intronic
1160995234 19:1879351-1879373 CAAGCGCAGGGCTGGGGACGTGG + Intronic
1161086863 19:2339457-2339479 CAGGTGCAGGGCTGGGCAGGTGG + Intronic
1161216336 19:3096708-3096730 CAGGCTCACAGAGTGGGAGGGGG - Intronic
1161266683 19:3367484-3367506 GAGGCTACGGGAGGGGGAGGGGG - Intronic
1161524167 19:4743143-4743165 CAGGGATAGGGATGGGGAGCAGG + Intergenic
1161631715 19:5360166-5360188 GAGGCTCAGAGATGGGCAGGGGG - Intergenic
1161711067 19:5848330-5848352 CAGGCTAAGGGAGAGGAAGGAGG - Intronic
1161778697 19:6278044-6278066 CAGGCGCCGAGATGGGCAGGAGG + Intronic
1161837803 19:6659812-6659834 CGGGGTAAGGGATGGGGATGAGG + Intergenic
1161865371 19:6828953-6828975 CAGGCTCCTAGATGGGCAGGTGG + Intronic
1161942612 19:7415197-7415219 CAGGAGCAGGGTTAGGGAGGTGG - Intronic
1162362935 19:10230615-10230637 CCGGCTCAGGGATGGGTCGTGGG - Intronic
1162566659 19:11448524-11448546 CAGGTTCCTGGAAGGGGAGGCGG - Exonic
1162762403 19:12896482-12896504 CAGGCTCCGTGCTGGGGACGCGG + Intronic
1162789509 19:13055613-13055635 CAGCCTCAGGGCTGGGGGAGGGG + Intronic
1162966092 19:14156810-14156832 CAGCCTCTGGGATCAGGAGGAGG + Intronic
1163029914 19:14537261-14537283 CGGGACCAGGGAGGGGGAGGCGG + Intronic
1163029924 19:14537281-14537303 CGGGACCAGGGAGGGGGAGGCGG + Intronic
1163047921 19:14658597-14658619 CAGGCAGAGGGGTGGGCAGGTGG + Intronic
1163302595 19:16457403-16457425 CAGGCTCAGCCATGGAGGGGGGG - Intronic
1163518079 19:17776736-17776758 CAGGCGGAGACATGGGGAGGTGG - Intronic
1163578326 19:18123446-18123468 CAGGGTCAGGGCTGGGGTGAAGG - Intronic
1163612339 19:18308036-18308058 CAGCCCCAGGGATGGGGAAGGGG + Intronic
1163679333 19:18671615-18671637 GAGGCTGAGGGAGGGGCAGGGGG - Exonic
1163688506 19:18725659-18725681 GAGGCTCAGGAAGAGGGAGGAGG - Intronic
1163754808 19:19100452-19100474 CTGGCACAGGGAAAGGGAGGGGG - Intronic
1163847015 19:19643553-19643575 CAGGGACCGGGATGGGGATGGGG + Exonic
1164295162 19:23903508-23903530 CAGGCTGAGGGAGGAGGAGGAGG - Intergenic
1164635151 19:29786248-29786270 CAGGCTCGGCAATGGGGAGGTGG + Intergenic
1164650169 19:29885731-29885753 CAGGCTCAGGAGCTGGGAGGGGG - Intergenic
1164701238 19:30286081-30286103 CAGGCTCATGGCAGAGGAGGAGG - Intronic
1164838558 19:31375044-31375066 CAGGCTCAGGGGTGGGAACCTGG - Intergenic
1165066140 19:33229705-33229727 GAGGCTAGGGGCTGGGGAGGTGG - Intergenic
1165157245 19:33796216-33796238 CGGGCTCGGGGAGGGGGCGGGGG - Intronic
1165328354 19:35126825-35126847 CAGGCAGAAGGACGGGGAGGGGG + Intronic
1165365503 19:35362641-35362663 CTGGCAGAAGGATGGGGAGGAGG - Intergenic
1165497142 19:36159819-36159841 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
1165699502 19:37926590-37926612 GTGGCTCAGGCTTGGGGAGGGGG + Intronic
1165916034 19:39260896-39260918 CCATCCCAGGGATGGGGAGGGGG + Intergenic
1165963888 19:39558385-39558407 GAGGATCAGGGATGGTGTGGAGG + Intergenic
1166213222 19:41320485-41320507 TGGGCTGGGGGATGGGGAGGTGG - Intronic
1166304092 19:41928000-41928022 CCGGCGCAGGGGCGGGGAGGGGG - Intronic
1166306945 19:41940515-41940537 CAGATTCAGGAAAGGGGAGGGGG + Intergenic
1166339880 19:42131091-42131113 AAGGGTCAGGGCTGGGGTGGTGG - Intronic
1166343038 19:42150187-42150209 GGGGCACAGGGATGGGTAGGAGG - Intronic
1166361806 19:42255629-42255651 CAGGCTCAGGGTTGGGGGGTTGG - Intergenic
1166407493 19:42531508-42531530 CTGGCTCAGGTGTGTGGAGGAGG + Intronic
1166853725 19:45772100-45772122 CAGACTCAGGGATGGGGCTGAGG - Intronic
1167158734 19:47754670-47754692 CAGTGTCAGGGGTGGGTAGGAGG - Intronic
1167463492 19:49638446-49638468 CTCCCTCAGGAATGGGGAGGAGG + Intronic
1167622682 19:50568104-50568126 CCGGCTCCTGGGTGGGGAGGGGG + Intergenic
1167785193 19:51630252-51630274 CAGGCACAGGGGTGAGAAGGGGG - Intronic
1167787292 19:51646676-51646698 CAGGCACAGGGGTGAGAAGGGGG - Intronic
1167792330 19:51689960-51689982 GAGGCGCAGGGATGGGGCTGCGG + Intergenic
1168080012 19:54003188-54003210 CAGGCTCAGGGAGGGGGAGGCGG + Intronic
1168091212 19:54085819-54085841 CAGGGTCTGAGATGGGAAGGAGG - Intergenic
1168238003 19:55075799-55075821 AATGCTCAGGTATGCGGAGGCGG + Intronic
1168254829 19:55159579-55159601 CAAGCTCAGGGATGAGAAGATGG + Exonic
1168306507 19:55438828-55438850 CAGGCTCAGGGCTGGGTAAGTGG + Intronic
1168316987 19:55488811-55488833 CAGGGTCAGGGCTGGGGGGCGGG - Intronic
1168728718 19:58607161-58607183 CAGGCGCAGAGAGGGGGGGGGGG - Intergenic
925434779 2:3827306-3827328 CAGGGGCAGGGATGGGGGTGGGG + Intronic
926139369 2:10359268-10359290 CTGGCTCGGCGAGGGGGAGGTGG + Intronic
926312913 2:11687428-11687450 TGGGCTCAGGGAGGGGCAGGCGG + Intronic
926575297 2:14573558-14573580 CACACTCAGAGAAGGGGAGGAGG + Intergenic
926872779 2:17441401-17441423 CAGACTCAGGGCTGTTGAGGGGG - Intergenic
927204386 2:20597954-20597976 CAGGCTCAGCCCTGGTGAGGAGG + Intronic
927491665 2:23525270-23525292 CAGGCTCAGGGACAGGCAGTGGG - Intronic
928093557 2:28390963-28390985 AGGACGCAGGGATGGGGAGGGGG + Intergenic
928265253 2:29805842-29805864 AAGAGTCAGGGATGGAGAGGTGG - Intronic
928402006 2:30985814-30985836 AAGGCTGAGGGGAGGGGAGGGGG - Intronic
929061664 2:37930796-37930818 CTGCCTCAGGGAAAGGGAGGAGG + Intronic
929169708 2:38919360-38919382 CAGGTGCAGGGAAGAGGAGGTGG + Exonic
929310189 2:40415199-40415221 AAGTCTCAGGGCTGGAGAGGTGG + Intronic
929576413 2:43055490-43055512 CAGGCTCAGGGTGGGGGCCGGGG + Intergenic
930113185 2:47696301-47696323 CAGGTTCTGGGAGGGGGAGGAGG + Intronic
930221182 2:48748332-48748354 GAGGCTTAGGGATGGGGAAAGGG + Intronic
930421946 2:51165265-51165287 CAGGCTCAGGGCTGGTGCTGGGG + Intergenic
930529202 2:52570863-52570885 CAGGCCCAAGGATTGGAAGGGGG - Intergenic
930700953 2:54457114-54457136 CAAGCGCAGGGATGGGGCGGAGG - Intronic
930884969 2:56314951-56314973 CAGGCTCTGGGAAGGGAAGGAGG - Intronic
931638600 2:64362187-64362209 CAGGCTGAGTGATGAGGAGCAGG + Intergenic
931667783 2:64622744-64622766 CAGCCTCAGGGGAGTGGAGGGGG + Intergenic
931781027 2:65579623-65579645 CATGGTCAGGGCTGGGGCGGAGG - Intergenic
931906733 2:66850662-66850684 CAGGCTGGGGGATGGGAGGGAGG + Intergenic
931948121 2:67332872-67332894 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
932086977 2:68771298-68771320 CAGGCGGAGGGTTGGAGAGGGGG - Intronic
932330132 2:70894071-70894093 GAGGCAAAGGGAGGGGGAGGTGG + Intergenic
932492425 2:72130923-72130945 CCAGCTCAGGGGTGGGGAAGAGG - Exonic
932667295 2:73708037-73708059 CAGGGACAGGGATGGGGTGGGGG + Intergenic
932723743 2:74159819-74159841 CAGTCTCCGGGGTGGGGGGGGGG - Intronic
932780049 2:74554126-74554148 GAGGGCCAGGGAGGGGGAGGGGG - Exonic
933328114 2:80863930-80863952 CAGGCTGTGGGATGGGCTGGAGG + Intergenic
933773260 2:85756828-85756850 CAGGCTGGGGGCTGGGGGGGTGG - Intronic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
934760465 2:96852956-96852978 AAGGCTGAGGGATGAGGAGCTGG + Intronic
935051809 2:99530763-99530785 AAGGCTGAGGGATGAGGAGCAGG - Intergenic
935054338 2:99552635-99552657 CTGGGGCAGGGATGGGGAGGTGG + Intronic
935319430 2:101871609-101871631 CTGGCTGGAGGATGGGGAGGAGG - Intronic
935616649 2:105091236-105091258 CAAGATGAGGGATGTGGAGGTGG + Intronic
935673540 2:105575464-105575486 GATGCTCAGGGGTAGGGAGGAGG + Intergenic
935725487 2:106020384-106020406 CAGGCTCAGGGATGGTTGTGAGG + Intergenic
936153763 2:110035520-110035542 CAGGCCCAGGGAGCAGGAGGTGG - Intergenic
936190922 2:110335895-110335917 CAGGCCCAGGGAGCAGGAGGTGG + Intergenic
936493969 2:113001634-113001656 CAGGGTTGGGGCTGGGGAGGTGG - Intergenic
936502865 2:113080193-113080215 CAGCCTCAGAAATGGGCAGGGGG - Intergenic
937292027 2:120787546-120787568 CAGGCTGAGGGCTGGGGTGAAGG - Intronic
938277346 2:130038042-130038064 CAGGCCCAGGGCTGTGGCGGCGG - Intergenic
938328319 2:130428845-130428867 CAGGCCCAGGGCTGTGGCGGTGG - Intergenic
938361628 2:130692649-130692671 CAGGCCCAGGGCTGTGGCGGTGG + Intergenic
938438038 2:131299338-131299360 CAGGCCCAGGGCTGTGGCGGCGG + Intronic
938598301 2:132811622-132811644 CAGACTCAGGGCTGTTGAGGGGG - Intronic
940478905 2:154203127-154203149 CAGTGTGAGGCATGGGGAGGAGG + Intronic
940690773 2:156917829-156917851 AAGTCTCAGAAATGGGGAGGGGG - Intergenic
941029246 2:160493211-160493233 CAGGGTCAGGCCTGGGGAGGGGG - Intronic
941874629 2:170420105-170420127 CAGGACCCGGGATGCGGAGGTGG + Intronic
943347933 2:186762338-186762360 CAGGCTCTGGGATGCGGGGAGGG - Exonic
943421718 2:187674885-187674907 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
943593065 2:189822062-189822084 CACGCGCAGGCAGGGGGAGGTGG - Intronic
943806508 2:192131714-192131736 CAGGCTAAGGGAGAAGGAGGAGG - Intronic
944668437 2:201975586-201975608 CAGGCTGAGGGATGGTATGGAGG + Intergenic
945080572 2:206084497-206084519 AAGCCTCCGGGATTGGGAGGAGG - Intronic
945301632 2:208220703-208220725 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
945554558 2:211262753-211262775 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
946063326 2:216964787-216964809 CAGGCTTTGGGATGCTGAGGTGG + Intergenic
946136937 2:217655289-217655311 GAGGCTCAAGGATGAGGAAGGGG + Intronic
946325850 2:218984435-218984457 CAGGCTCCGGGAGGAGGAGCCGG - Intronic
946444529 2:219726974-219726996 GAGGCACAGGGATGGGGACAAGG + Intergenic
947152285 2:227128192-227128214 CAGGCTCAGGTAGGGGGAAGAGG - Intronic
947305078 2:228736807-228736829 CAATCTCTGGGTTGGGGAGGAGG - Intergenic
947434827 2:230064352-230064374 CAGGCTCAGACATTGGGAAGGGG - Intronic
947468049 2:230371793-230371815 CAGGTCCAGGGATTAGGAGGTGG - Intronic
948422761 2:237870701-237870723 CAGGACCAAGGCTGGGGAGGAGG + Intronic
948425911 2:237886448-237886470 GGGGCTCTGGAATGGGGAGGAGG + Intronic
948603398 2:239120074-239120096 CTGGCCCCGGGACGGGGAGGTGG + Intronic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
948627032 2:239275719-239275741 CAGCCTGAGGGGTGGGGAGTGGG - Intronic
948670384 2:239564616-239564638 CAGGTTCAGGGATTGGGACGTGG + Intergenic
948765578 2:240217089-240217111 CAGGGTGAGGGGTGGGGGGGTGG + Intergenic
948909995 2:240998229-240998251 CATGCTCAGGGCTGGGAAGGGGG + Intergenic
949058289 2:241941818-241941840 CGGGCTTAGGGGTGGGGTGGTGG + Intergenic
1168767465 20:391445-391467 CAGGCTCAGGGATACGGTGGCGG - Exonic
1168849232 20:965282-965304 CAGGCTCAGGGAGGGACGGGAGG + Intronic
1168990040 20:2087244-2087266 CAAGCACAGGGATGAGGAAGTGG + Intergenic
1169163901 20:3406847-3406869 CAGGCTGAGGCAGGGGGAGCTGG + Intronic
1169664121 20:8015585-8015607 CAGGTTCAGTGTTGGGGAGCTGG - Intronic
1170820291 20:19751839-19751861 CAGGCTCAGAGCAGGGGTGGTGG - Intergenic
1171173260 20:23034090-23034112 CTGGGACAGCGATGGGGAGGAGG - Intergenic
1172010403 20:31843013-31843035 CAGTCTCAGAGCTGGGGTGGAGG - Intergenic
1172032653 20:31992701-31992723 ATGACCCAGGGATGGGGAGGAGG + Intronic
1172094658 20:32454771-32454793 CAGGCTCAGGGAACAGGTGGCGG + Intronic
1172129265 20:32645034-32645056 CTGGCTTAGGAATGGGAAGGGGG - Intergenic
1172244646 20:33437685-33437707 CAGGCACAGGGAGGTGGCGGGGG - Intronic
1172313471 20:33935397-33935419 GAGGCCCAGGGCTGGGGAGCAGG - Intergenic
1172484654 20:35291080-35291102 TGGGCTCAGTGATGGGGAGCGGG - Intronic
1172700409 20:36850139-36850161 CTGGCTCAGGGGCGGGGAGCTGG + Intronic
1172842720 20:37911711-37911733 CAGGCACAGGGTGGGGGAGAGGG - Intronic
1172873021 20:38147496-38147518 CAGGCTCAGGGAGGGGCTGAGGG - Intronic
1172889771 20:38255841-38255863 AAGGCTCAGTGAGGGGCAGGGGG - Intronic
1172891828 20:38271194-38271216 GAGGCTCAGGGATGTGCTGGGGG - Intronic
1173018547 20:39248245-39248267 CTGGCTCAGCTATGTGGAGGAGG + Intergenic
1173503730 20:43571348-43571370 CAGACTCTGAGATGGAGAGGAGG + Intronic
1174079865 20:47963018-47963040 CAGGCTCAGGGAGTAGGAGGGGG - Intergenic
1174130450 20:48340456-48340478 CAGGCGCAGGACTGGGGATGTGG - Intergenic
1174421403 20:50401360-50401382 CAGGGACAGGGATGGGAAGGAGG - Intergenic
1174543401 20:51307033-51307055 CCTGCGCAGGGCTGGGGAGGAGG - Intergenic
1174606940 20:51768165-51768187 CTGGGGCAGGGCTGGGGAGGCGG - Intronic
1174624879 20:51905799-51905821 CAGGCTCTGGGAGGCTGAGGTGG - Intergenic
1174751056 20:53111904-53111926 CTGGGTCAGGGATGGGCAAGAGG + Intronic
1175273839 20:57754023-57754045 CGGGCTCAGGAATGAAGAGGAGG + Intergenic
1175284339 20:57827833-57827855 CAGGCTGGGGGATGGGGAAGGGG + Intergenic
1175345067 20:58267032-58267054 CAGGCTCAGGAAGGGGAGGGAGG + Intergenic
1175699236 20:61125157-61125179 CAGGCCCAGGAAAGGGGTGGCGG + Intergenic
1175873959 20:62220725-62220747 GAGGAGAAGGGATGGGGAGGAGG + Intergenic
1175907295 20:62387159-62387181 CGGGCTCAGGGCTGGGGCTGGGG + Intronic
1176056360 20:63151196-63151218 TGGGCACAGGGATGAGGAGGTGG - Intergenic
1176674802 21:9768145-9768167 GAAGCTCAGGGAGGGTGAGGGGG - Intergenic
1176969378 21:15248349-15248371 CTGGGTGGGGGATGGGGAGGGGG - Intergenic
1177198165 21:17924482-17924504 CAGGCCCAGGGAAGAGGAGTTGG - Intronic
1177319995 21:19508844-19508866 CAGGTTGGGGGATGGGTAGGTGG + Intergenic
1178441924 21:32605356-32605378 CAAGCTCAGGTATGGTGAGAAGG - Intronic
1179155958 21:38851517-38851539 CTGGAGCAGGGATGGGGAAGGGG + Intergenic
1179383980 21:40924741-40924763 CAGGCACAGGGTTGGGGGCGGGG + Intergenic
1179405545 21:41122398-41122420 CAGACCCAGGGTTGGGGAGATGG + Intergenic
1179450486 21:41465398-41465420 CAGGGTCAGGGAGGATGAGGAGG + Exonic
1179547821 21:42124357-42124379 CCGGCTCTGGGTTGGGGAAGTGG + Intronic
1179650514 21:42805485-42805507 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
1179892630 21:44344657-44344679 GAGGCCCAGGGCTGGGCAGGGGG - Intergenic
1179916019 21:44478788-44478810 GAGGCACAGGGATGGGGAACTGG + Intergenic
1179931506 21:44573901-44573923 CAGGCTCAGGCAGGGGGCCGGGG - Exonic
1179934246 21:44592320-44592342 CAGGCTCAGGCAGGGGGCCGGGG + Exonic
1179935388 21:44600764-44600786 CAGGCTCAGGCAGGGGGCCGGGG - Exonic
1179942031 21:44646571-44646593 CAGGCTCAGGGAGGGGGCCGGGG - Exonic
1179948622 21:44697329-44697351 CAGGCTCAGGCAGGGGGCCGGGG - Exonic
1180799451 22:18624958-18624980 CATGCACAGGGATGGGGGCGTGG + Intergenic
1180816269 22:18791633-18791655 CAGGCTCTAGGCTGGGGTGGGGG - Intergenic
1181059181 22:20273774-20273796 CAGGCTCATGGGTGCGGAGCAGG + Intronic
1181202458 22:21225965-21225987 CAGGCTCTAGGCTGGGGTGGGGG - Intronic
1181222267 22:21370308-21370330 CATGCACAGGGATGGGGGCGTGG - Intergenic
1181441113 22:22935603-22935625 CAGGCCAAGGGATGGGGTTGGGG + Intergenic
1181468091 22:23121181-23121203 CAGCCTCAGGTCTGGGGATGGGG - Intronic
1181540694 22:23571619-23571641 AAGACTGAGGGATGGGGAGGGGG - Intergenic
1181545080 22:23598088-23598110 CAGGCCAAGGGATGGGGGTGGGG - Intergenic
1181638026 22:24183301-24183323 CATGCACAGGGATGGGGGCGTGG - Intronic
1181681473 22:24498603-24498625 CAGCCTCAGGGCTGGCTAGGCGG + Intronic
1181699249 22:24610649-24610671 CAGGCTCTAGGCTGGGGTGGGGG + Intronic
1181815231 22:25431794-25431816 CAGGCCAAGGGATGGGGGTGGGG + Intergenic
1181858805 22:25802253-25802275 CAGGGCAAGGGATGGGGAGAGGG + Intronic
1181910864 22:26237122-26237144 GAGGCTCAGGGAGGGGAAGTGGG - Intronic
1181967951 22:26669700-26669722 CCCACCCAGGGATGGGGAGGAGG + Intergenic
1182097093 22:27633329-27633351 CAGTCTCTGGGTTGAGGAGGTGG + Intergenic
1182425010 22:30267148-30267170 CTGGGCCAGGGATGGGCAGGAGG + Intergenic
1182430125 22:30294328-30294350 GAGGCTAGGGGAGGGGGAGGAGG + Intronic
1182437616 22:30340855-30340877 CAGGCTCAGCTACAGGGAGGTGG - Intronic
1182774698 22:32822206-32822228 CAGCCTCGGAGATGGGGAGTTGG - Intronic
1182910755 22:33982148-33982170 CAGGCTGAGGGAGGGGAAAGGGG - Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183514546 22:38256706-38256728 AAAGCTCAGTGATGGAGAGGTGG - Intronic
1183520234 22:38292678-38292700 CTGGCTTGGGGAAGGGGAGGCGG - Intronic
1183529852 22:38347450-38347472 CAGGGCCAGGGGTGAGGAGGAGG + Intronic
1183701760 22:39454999-39455021 AAGGCTCAGGGAGGGAGAGAAGG + Intergenic
1183716341 22:39535556-39535578 CAAGCTGGGGGAGGGGGAGGGGG + Intergenic
1183735773 22:39644034-39644056 CTGGAGGAGGGATGGGGAGGTGG + Intronic
1183812157 22:40266412-40266434 AAGGATCAGGGGTGGGGAGGTGG + Exonic
1183947628 22:41335708-41335730 CAGGCTCAGGTGTGGGAAGGAGG + Intronic
1184270756 22:43381525-43381547 CAGGCTCTGAGATGGGGATTGGG + Intergenic
1184296267 22:43527422-43527444 CAAGTTCAGGGAAGGGGAAGGGG - Intergenic
1184437881 22:44490560-44490582 CAGACAGTGGGATGGGGAGGGGG + Intergenic
1184447298 22:44556413-44556435 GAAGCTGGGGGATGGGGAGGAGG - Intergenic
1185013583 22:48330903-48330925 CAGCCAGAGAGATGGGGAGGGGG - Intergenic
1185314680 22:50173970-50173992 CAGGCTCCGGGGTTGGGATGTGG + Intronic
1203224455 22_KI270731v1_random:69448-69470 CAGGCTCTAGGCTGGGGTGGGGG + Intergenic
1203266372 22_KI270734v1_random:17344-17366 CAGGCTCTAGGCTGGGGTGGGGG - Intergenic
949403439 3:3689543-3689565 CAAGCTCAGTGATGGAGAGGAGG + Intergenic
949418788 3:3842262-3842284 CAGACTTGGAGATGGGGAGGAGG + Intronic
949773861 3:7609558-7609580 CAGGCACAGGTATGGGTAGGTGG + Intronic
950061938 3:10078860-10078882 GAGGCTGAGGCATGGGGAGGAGG + Intronic
950127211 3:10517298-10517320 CAGGCTGGGGGAAGGGGAAGGGG - Intronic
950162707 3:10772188-10772210 CAGGCTCAGGGAAGAGGGGTGGG + Intergenic
950390716 3:12694427-12694449 CAGGCCCTGTGATGGGTAGGAGG - Intergenic
950539938 3:13606012-13606034 TGAGCCCAGGGATGGGGAGGGGG - Intronic
950660346 3:14463419-14463441 CAGGGACAGGGGTGTGGAGGTGG - Intronic
950720174 3:14876999-14877021 CAGCCTCAGGCAGGGGCAGGTGG + Intronic
950776713 3:15356530-15356552 CAGGCTTATGGAGTGGGAGGTGG + Intergenic
950873762 3:16251577-16251599 TGGGCTGGGGGATGGGGAGGAGG - Intergenic
951078271 3:18423950-18423972 CAGGGTTTGCGATGGGGAGGAGG + Exonic
951343408 3:21516587-21516609 AAGGCCCAGTTATGGGGAGGTGG - Intronic
951563395 3:23989508-23989530 GAGGCACAGGGTTGGGGAGAGGG - Intergenic
951894725 3:27599988-27600010 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
951944730 3:28123008-28123030 TAGCCCCAGGGATGGGAAGGGGG + Intergenic
952177876 3:30886511-30886533 AAGGCCAAGGGATGGGGAGTGGG + Intronic
952708599 3:36406149-36406171 CAGGCTGCTGGGTGGGGAGGGGG - Intronic
952896197 3:38080691-38080713 CAGGCTAAGGGAGGAGAAGGAGG + Intronic
953006344 3:38982728-38982750 ATGGCTCAAGGATGGGGTGGGGG + Intergenic
953027572 3:39153715-39153737 CAGGCTCCAGGCGGGGGAGGAGG - Intronic
953126536 3:40096061-40096083 AAGGCTCAGGGTTGGGGGTGTGG - Intronic
953416660 3:42724419-42724441 CAGCCTCAGGTCTGGAGAGGGGG - Intronic
953570176 3:44065259-44065281 CAGGCTCTGAGTCGGGGAGGTGG - Intergenic
953865594 3:46580520-46580542 CATGGTAAGGTATGGGGAGGGGG - Intronic
954109339 3:48425427-48425449 CAGGCTGGGCGGTGGGGAGGGGG - Intronic
954176147 3:48847420-48847442 CAGGCTCTGGCGTGGGGTGGCGG + Exonic
954263367 3:49455836-49455858 CAGGGTAAGGAATTGGGAGGAGG - Intergenic
954462979 3:50638230-50638252 CAGGCAGGGGGAGGGGGAGGAGG + Intronic
954635368 3:52068236-52068258 CTGGCCCAGGCTTGGGGAGGGGG - Intergenic
954693638 3:52409320-52409342 GATGCTTAGGGGTGGGGAGGGGG + Intronic
954803997 3:53204715-53204737 CAGGCTGTGGGACAGGGAGGGGG + Intergenic
955319188 3:57962032-57962054 CAGGTCCAGGGCTGGGGTGGTGG - Intergenic
955356245 3:58235587-58235609 CCGGCTCAGGGAGGGGCCGGAGG + Intergenic
955780368 3:62478190-62478212 CAGACTCAGGGAAGGGTAGATGG - Intronic
955802129 3:62697258-62697280 CAGGGGAAAGGATGGGGAGGGGG - Intronic
955960773 3:64339480-64339502 AGGGCTCAGGGACGGAGAGGTGG + Intronic
956878647 3:73488866-73488888 CAGCAGCAGAGATGGGGAGGAGG - Intronic
957040262 3:75330721-75330743 CAGGCTAGGGGAAGGGGTGGGGG + Intergenic
957083104 3:75655566-75655588 CGGGCTGGGGGAGGGGGAGGAGG + Intergenic
958480816 3:94643602-94643624 CAGACTCAGGGCTGTGGTGGAGG - Intergenic
958798803 3:98733107-98733129 GAGGCTCAGGGTTGGGGGTGGGG + Intronic
959902830 3:111679255-111679277 GAGGGTCAGGGTTGGGAAGGAGG + Intronic
960082380 3:113554827-113554849 CAAGCTCAGGCATGGGCATGTGG + Intronic
960310254 3:116109735-116109757 CAGGCTGAGGGAGAAGGAGGAGG + Intronic
960474423 3:118106910-118106932 CAGGCTCTGAGCTGGGTAGGTGG - Intergenic
961019127 3:123489311-123489333 CAGGGTCTGCGATGGGGAGGAGG + Intergenic
961045055 3:123702301-123702323 CAGGCTAGGGGAAGGGGTGGGGG + Intronic
961448662 3:126992616-126992638 CAGGCTCTGGGCTGGGGGCGGGG + Intronic
961621572 3:128228566-128228588 GAGGGTCAGGGTTGGGGAGTCGG + Intronic
961711764 3:128833619-128833641 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
961730439 3:128961007-128961029 CAGGCTAAGGGAGAAGGAGGAGG - Intronic
962024193 3:131529690-131529712 CAGTGTCAGGGATGGTGGGGTGG - Intergenic
962169241 3:133083185-133083207 CAGGCTGAGGAGTGGGGCGGCGG - Intronic
962736432 3:138329597-138329619 CCGGCTCCGGGGTGGGGAGGGGG - Intronic
963008780 3:140750341-140750363 ATGGCTCAGGGATGGTGAGTGGG + Intergenic
963603056 3:147393572-147393594 CCGGCTCAGGGTCGGAGAGGAGG - Intronic
963832998 3:150028882-150028904 GAGGCTCAGGGAAAGGGTGGGGG + Intronic
963907421 3:150784038-150784060 CTGGCTGGGGGATGGGGAGTGGG + Intergenic
964705649 3:159616051-159616073 CAGTCTCAGTGATGGGAATGTGG + Intronic
964983498 3:162713652-162713674 CAGGCTAAGGGAGGAGAAGGAGG - Intergenic
965153108 3:165008310-165008332 CAGGCTCAGGGCAGGAGTGGAGG - Intronic
965286871 3:166828523-166828545 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
966066700 3:175829001-175829023 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
966283957 3:178270884-178270906 CTGGCTCAGGGTTGGGAAGGAGG + Intergenic
967216908 3:187218872-187218894 GAGGCTCAGGGGTGAGGAGTCGG + Intronic
967738423 3:192979205-192979227 CAGACTCTGGGAAGGGTAGGAGG + Intergenic
968131280 3:196194219-196194241 CAGGACCAGGGATGGGGCAGCGG + Intergenic
968478210 4:822543-822565 CAGGGTCGGGGAGGGGGAGCTGG - Intronic
968514264 4:1009803-1009825 CAGGGGCGGGGACGGGGAGGGGG - Intergenic
968557168 4:1251445-1251467 CAGGCCCAGGCACAGGGAGGCGG - Intergenic
968564990 4:1307316-1307338 CAGGGGCTGGGGTGGGGAGGAGG - Intronic
968645765 4:1739864-1739886 CGGGGACAGGGATGGCGAGGGGG - Intronic
968810130 4:2796015-2796037 CAGGCCAAGGGGTGGTGAGGAGG - Intronic
968834012 4:2949620-2949642 GAGGGGCAGGGCTGGGGAGGTGG - Intronic
968901831 4:3435664-3435686 CAGGCTGGGGGCTGTGGAGGAGG - Intronic
968927232 4:3556043-3556065 CAGGCTCAGAGCTGGGGAACCGG - Intergenic
968957293 4:3725896-3725918 CCAGCTCAGGGAAGGGCAGGTGG - Intergenic
969198696 4:5584593-5584615 CAGGCGCTGGGAAGGAGAGGGGG - Intronic
969214466 4:5711140-5711162 CAGGGGCAGGGCTGGGGCGGGGG + Intergenic
969229381 4:5819253-5819275 CAGGCCCAGGGATTAGGATGTGG - Intronic
969232111 4:5839212-5839234 CAGGATCAGGGATGGAGACAAGG - Intronic
969480015 4:7442279-7442301 TGGGCTCAGGGAGGGGGTGGAGG - Intronic
969503545 4:7569901-7569923 CATCCACAGGGGTGGGGAGGAGG - Intronic
969523435 4:7692128-7692150 GATGCTCAGGGCTGGAGAGGAGG - Intronic
971140108 4:23915896-23915918 AAGGCACAGGGAGGGGGTGGTGG - Intergenic
971180412 4:24324503-24324525 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
972631485 4:40845960-40845982 CAGCTTCAGGGGTGGGTAGGTGG + Intronic
972762363 4:42119438-42119460 CAGGCAGAGGGGTGGGAAGGAGG - Intronic
973646572 4:52956428-52956450 CAGGCTGAGGGAAGGGCAGGTGG + Intronic
973782370 4:54300572-54300594 CAGACTCAGGGCTGTTGAGGTGG + Intergenic
973993807 4:56436497-56436519 CTGCCTCGGGGATGGGGAGAAGG + Intronic
974070657 4:57120440-57120462 CAGGCTTTTGGGTGGGGAGGTGG + Intergenic
975781946 4:77849151-77849173 GAGGCTGGGGGCTGGGGAGGGGG - Intergenic
976087964 4:81425636-81425658 CAGGCTCTGGGCTGGAGGGGCGG - Intergenic
976231195 4:82845085-82845107 CAGGCAGATGGATGGGGAGTGGG + Intronic
977581407 4:98729032-98729054 GAAGCTCAGGGAAGGGGTGGAGG + Intergenic
977827811 4:101554286-101554308 CAGACAAAGGGGTGGGGAGGGGG - Intronic
978127163 4:105147824-105147846 CAGGCGCAGGCCCGGGGAGGGGG + Intronic
978277353 4:106967904-106967926 CAGGTTAAGGGATGGAGAGAGGG + Intronic
979895303 4:126149557-126149579 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
980239627 4:130156836-130156858 CTGGCTCAGGAAAGGTGAGGTGG - Intergenic
980450126 4:132959186-132959208 CAGGCTTCTGGAAGGGGAGGGGG + Intergenic
981940650 4:150278449-150278471 CAGGCTCAGGGAAGGTGCCGAGG - Intronic
982263065 4:153512556-153512578 AAGGCTCAGGGATGAGGAGAGGG - Intronic
982334235 4:154215513-154215535 GAGGCAGTGGGATGGGGAGGAGG + Intergenic
983938380 4:173518614-173518636 CAGGTTCTGGAATGGGGAGAAGG - Intergenic
985038944 4:185869110-185869132 CAGGCACTGGAATGGGCAGGTGG + Intronic
985321448 4:188716384-188716406 CAGCCTCTGGGAGGGTGAGGCGG - Intergenic
985552735 5:541649-541671 CAGGCCCTGTGATGGGCAGGGGG - Intergenic
985646622 5:1088039-1088061 CAGGCAGCGGGCTGGGGAGGGGG - Intronic
985782461 5:1878368-1878390 CTGGCTCAGGGAGGTGGCGGCGG + Exonic
985790931 5:1926506-1926528 CAGGCTCAGGGGCGGGGCAGGGG - Intergenic
985790953 5:1926570-1926592 CAGGCTCAGGGGCGGGGCAGGGG - Intergenic
986341555 5:6793573-6793595 GAGGCTCAGTGAGGGTGAGGGGG - Intergenic
986353421 5:6902109-6902131 TAGGCTCAGGGATGTAGAGAAGG + Intergenic
986543680 5:8872942-8872964 ATGGCTCAGGGAGGGGCAGGGGG - Intergenic
986767030 5:10937607-10937629 CAGGCTCTGGGGAAGGGAGGTGG + Intergenic
986806536 5:11313229-11313251 CCTGCTCAGGGAGGAGGAGGAGG - Intronic
986992792 5:13573191-13573213 AAGGCACAAGGATGGGGAAGAGG - Intergenic
987050567 5:14144115-14144137 CGGGCGCAGGGAGGGCGAGGTGG - Intronic
987282143 5:16422840-16422862 GAGGCTTTGGGATGGGGAGAAGG - Intergenic
988608781 5:32705548-32705570 GAGGAAGAGGGATGGGGAGGGGG + Intronic
988799865 5:34686321-34686343 CAGGAGCAGGGGTGGGGATGTGG + Intronic
989146495 5:38256082-38256104 CAGGGCCAGGGATGCCGAGGTGG + Intergenic
989173777 5:38500076-38500098 GAGGCTGAGGGATAAGGAGGGGG - Intronic
989732400 5:44664442-44664464 GAGGCCCAGGGAAGGGGAGCAGG - Intergenic
990749728 5:59001252-59001274 CAGGCTTTGAGATGGAGAGGAGG - Intronic
990955573 5:61334907-61334929 CAAGCACAGGGAGAGGGAGGGGG - Intronic
991034073 5:62110146-62110168 CAGGCTCAGGGATGAAGAGATGG + Intergenic
991528271 5:67587888-67587910 TAGGCTGAGGGTTGGGGAAGAGG + Intergenic
992150180 5:73895005-73895027 CAGGCTGAGGGAAGGGAGGGTGG + Intronic
992488530 5:77218568-77218590 CAGGCAGAGGGAAGGGGAGCAGG + Intronic
992980257 5:82162829-82162851 CAGGGGCGGGGGTGGGGAGGAGG + Intronic
994029665 5:95127475-95127497 CAGGTTCAGGGCAGTGGAGGTGG + Intronic
994685606 5:102947522-102947544 CAGGGTAAAGGATGGGAAGGAGG + Intronic
994775546 5:104032901-104032923 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
995043829 5:107621267-107621289 CAGGCCCAGGGTTGGGAAGCCGG + Intronic
995177645 5:109197459-109197481 CAAGCTCAGGGATGAGGAGGGGG - Intergenic
995256208 5:110049659-110049681 CAGCCCCAGGGATGGAGAAGTGG - Intergenic
997180108 5:131819452-131819474 CAGGGGGAGGGAGGGGGAGGGGG + Intronic
997232407 5:132254401-132254423 CAGGCTCTTGGCTGGGGAGACGG + Intronic
998039264 5:138941962-138941984 CAGGCCCAGGGATTAGGATGTGG - Intergenic
998056745 5:139085111-139085133 CAGGCTAAGGGACGGGGGAGTGG + Intronic
998170629 5:139870319-139870341 AAGGTTCAGGGAGGGGGAGAAGG + Intronic
998372429 5:141670503-141670525 CAGGGGCCGGGATGGTGAGGGGG - Exonic
998816294 5:146017534-146017556 GTGGGACAGGGATGGGGAGGAGG - Intronic
998996533 5:147873322-147873344 CAGGCTAAGGGAGAAGGAGGAGG + Intronic
999141114 5:149362793-149362815 CAGGCTCAGGGAGTGGAAGGAGG - Exonic
999174721 5:149624017-149624039 CAGGCTCTGGGACGTGGTGGTGG - Exonic
999239543 5:150119595-150119617 CAGGCTCAGGGGTGGAAAAGTGG + Intronic
999486730 5:152004386-152004408 CGAGCTCATGGATTGGGAGGGGG + Intergenic
999500167 5:152138951-152138973 AAGGCACAGAGATGGGGAAGGGG + Intergenic
999762374 5:154712636-154712658 CAGGACCAGGGCTGTGGAGGAGG + Intergenic
1000082524 5:157861428-157861450 CAGGCCCAGGGGAGGGAAGGTGG - Intergenic
1000519552 5:162279812-162279834 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
1000538047 5:162504418-162504440 CAGGCTTAGGGAAGGAGAGGAGG - Intergenic
1001099864 5:168805298-168805320 CACACACAGGGAAGGGGAGGAGG + Intronic
1001289110 5:170443887-170443909 CAGGCCCAGGGCAGGGGTGGGGG + Intronic
1001289214 5:170444535-170444557 CAGGCATAGGGATGAGGATGCGG + Intronic
1001424195 5:171612820-171612842 CAGGGTCTGGGCTGGGGTGGGGG - Intergenic
1001425273 5:171618516-171618538 CAGCCCCAGGAAAGGGGAGGAGG - Intergenic
1001444540 5:171773236-171773258 CAGTCTCAGGGAGGTGGTGGGGG + Intergenic
1001824593 5:174734902-174734924 CAGGGACAGGGATGGGGTGGGGG + Intergenic
1001913326 5:175539112-175539134 CAGGCTCAGAGATGTGAAAGTGG - Intergenic
1002345296 5:178544375-178544397 CAGGCGCAGGGCCGGGGAGCTGG + Intronic
1002375174 5:178783673-178783695 CAGGCACGGGGCTAGGGAGGGGG - Intergenic
1002437898 5:179243561-179243583 CAGCCTCAGAGATGGGGGAGGGG + Intronic
1002450612 5:179316402-179316424 CAGGAGCAGGGCTGGGGAGTCGG + Intronic
1002520703 5:179792061-179792083 CAGGCTCAGAGGGAGGGAGGTGG + Intronic
1002562700 5:180093085-180093107 CAGGCCCAGGGAGGGAGAGCCGG - Intergenic
1003234094 6:4281029-4281051 CAGGCTAGGTGATGGGGAGAAGG - Intergenic
1003299170 6:4861319-4861341 CAGGCTGGTGGCTGGGGAGGAGG + Intronic
1003476529 6:6488721-6488743 CAGGCTTATGGATGGGGAACTGG - Intergenic
1004143829 6:13046432-13046454 GATGCTAAGGGATGGGGTGGAGG + Intronic
1004357563 6:14943352-14943374 CAGGCTAAGTGAAGGGCAGGTGG - Intergenic
1004681833 6:17903632-17903654 CAGGCACAGGGATGGGGATGTGG + Intronic
1004836861 6:19540167-19540189 CAGGCTAAGGGATAAGAAGGAGG - Intergenic
1005049095 6:21667001-21667023 CAGGGTCAGGGCTAGGGTGGGGG - Intergenic
1005083435 6:21980486-21980508 CAGGAGCAGGGAGGAGGAGGTGG - Intergenic
1005406901 6:25498995-25499017 CAAGGTCAGGGAGTGGGAGGAGG + Intronic
1005838529 6:29725053-29725075 CATGGTCAGAGATGGGGTGGTGG - Exonic
1005859437 6:29889351-29889373 CATGGTCAGAGATGGGGTGGTGG - Intergenic
1005867001 6:29944144-29944166 CATGGTCAGAGATGGGGTGGTGG - Exonic
1005868708 6:29957460-29957482 CATGGTCAGAGATGGGGTGGTGG - Intergenic
1005885989 6:30098199-30098221 CAGGATCAGGTCTGGGAAGGGGG + Intergenic
1006052524 6:31355548-31355570 CATGGTCAGAGATGGGGTGGTGG + Exonic
1006154448 6:32006746-32006768 GAGGCTCAGGGAGGGGCTGGGGG - Intergenic
1006160761 6:32039482-32039504 GAGGCTCAGGGAGGGGCTGGGGG - Intronic
1006300544 6:33191640-33191662 AGGGCACAGGGAGGGGGAGGGGG + Intronic
1006444003 6:34068807-34068829 CTGGCTCAGGGGTCTGGAGGAGG - Intronic
1006778673 6:36616931-36616953 GAGGCCCAGGGAGGAGGAGGGGG + Intergenic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1007154879 6:39732820-39732842 CAGGGGCAGGGAAGAGGAGGTGG - Intergenic
1007246784 6:40468972-40468994 CAGGTTCAGGGATTAGGACGTGG - Intronic
1007301474 6:40871074-40871096 CAGCAGCAGGGATGAGGAGGAGG + Intergenic
1007341575 6:41194200-41194222 GAGGGTCGGGGGTGGGGAGGAGG - Intronic
1007397462 6:41585918-41585940 CAGGCTGAGGTAAGGGGAGGTGG - Intronic
1007590181 6:43016340-43016362 CAGTAGCAGGGATGGGGAAGTGG + Intronic
1007634633 6:43291388-43291410 CAGCTTCATGGATAGGGAGGGGG - Intergenic
1007675921 6:43594935-43594957 AAGGCTGGGGGCTGGGGAGGTGG + Intronic
1007777055 6:44229803-44229825 CAGGCTGGGGGCTGGGGAGGGGG - Intronic
1008091312 6:47296573-47296595 CAACCTCAGGGAAGGGGAGAAGG + Intronic
1008674554 6:53805932-53805954 AAGGCTGAGGGAAGGTGAGGTGG - Intronic
1009498990 6:64387136-64387158 AGGTCTGAGGGATGGGGAGGTGG - Intronic
1009842360 6:69093207-69093229 CAGGCTAAGGGAGAGAGAGGTGG + Intronic
1010346207 6:74814318-74814340 CTGGCTCAGGGATAGGGTGATGG - Intergenic
1010456653 6:76064020-76064042 GAGGCACAGGAATGGAGAGGGGG + Intronic
1011155810 6:84329796-84329818 AGGGAGCAGGGATGGGGAGGGGG + Intergenic
1011726627 6:90216293-90216315 CAGCCGCTGGAATGGGGAGGAGG + Intronic
1011771085 6:90674644-90674666 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
1012066682 6:94558366-94558388 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
1013392790 6:109703688-109703710 CAGTCTCAGGGACAGAGAGGGGG - Intronic
1013491543 6:110651087-110651109 CAGGCAAAGGGTTGGGAAGGGGG + Intronic
1014914205 6:127125805-127125827 TAGGCTCAGGGTTAGGGAGCTGG + Intronic
1015185306 6:130408933-130408955 CAGGGTCAGGGAGGGGGTGGTGG - Intronic
1015497477 6:133896066-133896088 CTGGCTCAGGGATGAGGCGCAGG + Intergenic
1016396770 6:143632071-143632093 CAGGGCCAGGGAGGGGCAGGGGG - Intronic
1016429057 6:143964083-143964105 CAGGCCCTGGGATGGGGGGTTGG - Intronic
1017065900 6:150528817-150528839 CAGGCGGAGGGAAGTGGAGGAGG - Intergenic
1017437616 6:154431656-154431678 CATGGTGAGGGATGGGGTGGTGG - Intronic
1017474856 6:154780168-154780190 AGGGATTAGGGATGGGGAGGAGG - Intronic
1018048778 6:159989288-159989310 CTAGTTCAGGGTTGGGGAGGAGG + Intronic
1018416712 6:163607977-163607999 CTGGTTCAGGGATGGGCGGGCGG + Intergenic
1018719423 6:166561496-166561518 TGGGCTCAGCAATGGGGAGGGGG - Intronic
1018810503 6:167294924-167294946 CAGCATCGGGGATCGGGAGGAGG - Intronic
1018842317 6:167526291-167526313 CAGGCTCAGGGGTGAGGTGTGGG - Intergenic
1018861435 6:167713129-167713151 CAGGCTCAGGGAAGTGGCTGGGG + Intergenic
1018900514 6:168049680-168049702 CAGGCTCAGGAGAGGAGAGGAGG + Intergenic
1018900837 6:168050992-168051014 CAAGCCCCGGGATGGGGTGGGGG + Intergenic
1018932852 6:168253270-168253292 CATACTCAGGGGTGGGGTGGGGG - Intergenic
1019194222 6:170271826-170271848 CGGGCTACGGGCTGGGGAGGAGG + Intergenic
1019360446 7:601917-601939 GAGGCGCAGGGACGGGCAGGGGG + Intronic
1019360453 7:601929-601951 CGGGCAGGGGGATGGGGAGGGGG + Intronic
1019855191 7:3598617-3598639 CAGGGCCAGGGATGGGGACAAGG - Intronic
1020013102 7:4816945-4816967 GAGGGTCAGGGATGAGGTGGGGG - Intronic
1020094098 7:5358476-5358498 CAGGCTCATGGAGGGAGACGGGG - Intronic
1020274694 7:6616987-6617009 GAGGCTCAGGACTGGGGAGTTGG - Intronic
1020280774 7:6648964-6648986 AAGGCTCAGGGCTGGGGCTGGGG - Intronic
1021172518 7:17415053-17415075 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
1021723843 7:23531500-23531522 AAGCCTCAGGGGTGGGGAGAAGG + Intronic
1021902148 7:25296743-25296765 CAGGCTCAGAGACGCAGAGGGGG - Intergenic
1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG + Intergenic
1022143370 7:27512871-27512893 AAGACTCAGGGACAGGGAGGTGG + Intergenic
1022359454 7:29644311-29644333 CGGGGTAAGGGATGGGGATGAGG + Intergenic
1023010008 7:35917913-35917935 CAGGATGAGGGGTGAGGAGGAGG - Intergenic
1023844490 7:44113171-44113193 CAGGCTCCTGGATGGGCGGGAGG + Intronic
1023844805 7:44114579-44114601 AGGTGTCAGGGATGGGGAGGAGG + Intergenic
1023869528 7:44255577-44255599 CAGGCGGGGGGATGGGGAAGAGG - Intronic
1024080823 7:45853666-45853688 CAGGATGAGGGGTGAGGAGGAGG + Intergenic
1024261000 7:47573686-47573708 CAGGCCCAGAGACGGGGTGGTGG - Intronic
1024573231 7:50742716-50742738 GAATCTCGGGGATGGGGAGGGGG + Intronic
1024733117 7:52274321-52274343 CCAGCACAGGGATGCGGAGGGGG - Intergenic
1024912796 7:54465258-54465280 CAGGAGCAGGGATAAGGAGGTGG - Intergenic
1025230843 7:57202459-57202481 TGGGCCCAGGGATGGGGAGGAGG - Intergenic
1025249423 7:57342104-57342126 CAGGGACAGGGATGGGAAGGAGG + Intergenic
1025301070 7:57820008-57820030 CAGGCTCAGGGCTTGGCTGGCGG + Intergenic
1025813700 7:64890785-64890807 CAGGCTCAGTGATGGGGCAAAGG + Intronic
1025847941 7:65217290-65217312 CAGGATGGGGGGTGGGGAGGAGG - Intergenic
1025936194 7:66039599-66039621 CAGGATGAGGGATGGAGAGGGGG + Intergenic
1025947973 7:66119304-66119326 CAGGGTGAGGGATAGAGAGGGGG - Intronic
1026451126 7:70530619-70530641 CAGGCTGGGGGCTGGGGAAGAGG - Intronic
1026461506 7:70619131-70619153 CCGGCAAGGGGATGGGGAGGGGG - Intronic
1026613180 7:71878936-71878958 CTGGGTCAGGGATGGGGTGCTGG + Intronic
1026974709 7:74490334-74490356 CAGGCTCTGGGCTGGGCAGCGGG - Intronic
1028292554 7:89084233-89084255 CAGTCTCAGGGAGTGGGAGTGGG + Intronic
1028482473 7:91322619-91322641 CATTCTCAGGGATGGGTTGGGGG + Intergenic
1028511576 7:91630973-91630995 CTGGCTGAAGGATTGGGAGGAGG + Intergenic
1028690032 7:93641139-93641161 CAGGCTAAGGGAGAAGGAGGAGG - Intronic
1028995280 7:97093291-97093313 CAGGGACAGGCCTGGGGAGGTGG - Intergenic
1029117168 7:98243341-98243363 CAGGAGCAGGCATGGGGTGGGGG + Intronic
1029155162 7:98512101-98512123 CAGGCACAGGGCTGGTGAGAGGG + Intergenic
1029232043 7:99078518-99078540 CAGCCTGGGGGATGGGGAGGAGG - Intronic
1029248615 7:99220374-99220396 CAGCCCCAGGGCTGGGGAGCAGG - Intergenic
1029350851 7:100011853-100011875 CAGGGAGAGGGAAGGGGAGGAGG + Intergenic
1029440681 7:100585225-100585247 CAGGCTTAGGAAGGAGGAGGAGG + Intronic
1029619617 7:101681791-101681813 AGGGCACAGGGATGGGGAGGGGG - Intergenic
1030048858 7:105521221-105521243 GAGGCTTGGGGATGGGGGGGAGG + Intronic
1030638258 7:111974575-111974597 AAGGAAAAGGGATGGGGAGGAGG + Intronic
1031296467 7:120010146-120010168 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
1031422606 7:121568450-121568472 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
1032191677 7:129769398-129769420 CAGGCCGAGGGCTGGGGAGCAGG + Intergenic
1032529861 7:132611036-132611058 CAGTCTCAGAGATGGGGAAAGGG - Intronic
1032720912 7:134550291-134550313 CAGGGTAAGGGATGGGGATGAGG - Intronic
1033312937 7:140275403-140275425 TATGCGCAGGAATGGGGAGGTGG + Intergenic
1034275326 7:149821468-149821490 CAGGCACAGGGGTGGGCACGAGG - Intergenic
1034282527 7:149864113-149864135 CAGGCTCAGGAAGGAGGAGATGG + Exonic
1034536883 7:151730878-151730900 TGGGCTCATGGAAGGGGAGGTGG + Intronic
1034547892 7:151800935-151800957 CAGGGTCAGGGAGGGGCAGATGG + Intronic
1034877555 7:154738968-154738990 CTAGATCAGGGATGGGGAGGAGG + Intronic
1034880585 7:154759527-154759549 AAGGCTCAGGGAGAGGGAAGCGG - Intronic
1035019029 7:155789386-155789408 CAGACTCAGGGAGGGGCTGGAGG - Intergenic
1035136625 7:156709549-156709571 CAGGCTCTGGGATGGTGCGGGGG - Intronic
1035307635 7:157943495-157943517 CAGGAGCAGGGATGGGGCGGAGG - Intronic
1035389548 7:158496269-158496291 GGGGCACAGGGAAGGGGAGGGGG - Intronic
1035389792 7:158496855-158496877 GGGGCACAGGGAAGGGGAGGGGG - Intronic
1035389888 7:158497087-158497109 GGGGCGCAGGGAAGGGGAGGGGG - Intronic
1035389913 7:158497146-158497168 GGGGCTCAGGGAAGGGGAGGGGG - Intronic
1035426898 7:158784050-158784072 AAGGCACAGGGAGGAGGAGGAGG + Intronic
1036135638 8:6158725-6158747 GAGGCACAGGGATGGGAAGGTGG - Intergenic
1036550639 8:9812595-9812617 CAGGGACTGGGATGGGGATGAGG - Intergenic
1036643951 8:10600791-10600813 GAAGCTCAGGGACGAGGAGGAGG - Intergenic
1036668519 8:10764262-10764284 CAGACACAGGGCTGGGAAGGTGG + Intronic
1037783691 8:21889145-21889167 GAGGCCCAGGGATGGGGTGAAGG + Intergenic
1038494195 8:27990161-27990183 CCAGCTGAGGGGTGGGGAGGAGG - Intronic
1038546790 8:28431895-28431917 GAGGCTCAAGGATGAGGTGGGGG - Intronic
1038627608 8:29209279-29209301 CAGGCTCATGGAGGGCGAGAAGG + Intronic
1038988880 8:32844321-32844343 CAGGTGCAAGGATGGGGAAGTGG - Intergenic
1039967061 8:42291117-42291139 CAGCCTCAGAGATGGAGAGGTGG - Intronic
1040416592 8:47201173-47201195 CAGACTCAGGGGAGGGGAGCAGG + Intergenic
1040508415 8:48072244-48072266 CTGGAACAGGGATGAGGAGGAGG - Intergenic
1040564633 8:48554661-48554683 CAGACACAGGCATGGGGAGTTGG + Intergenic
1040670339 8:49682319-49682341 CACCCTGTGGGATGGGGAGGAGG - Intergenic
1040783543 8:51139482-51139504 CAGGGCCAGGGATGTGGTGGAGG - Intergenic
1041124094 8:54617669-54617691 CAGCCTCAGGGATTGGGGGTAGG - Intronic
1041300606 8:56407643-56407665 CAGGGTCAGGGTTGAGGTGGAGG - Intergenic
1042453408 8:68974446-68974468 CAGGCTAAGGGAGGAGGAGGAGG - Intergenic
1043226983 8:77745678-77745700 CAGCCTGAGGTTTGGGGAGGGGG - Intergenic
1044858668 8:96500194-96500216 CAGCCTCAGGGAAGAGGAGGAGG - Intronic
1044999570 8:97868531-97868553 CAGGCCCCGGGATGGGGAGGAGG - Intergenic
1045224292 8:100229527-100229549 CTGGCTCAGGGATGGGCACATGG - Intronic
1047768759 8:128013172-128013194 GAGGCACAGGGAAGGGGGGGTGG - Intergenic
1047784075 8:128136567-128136589 CAGGCTGAAGGATGGAGAAGGGG - Intergenic
1048135336 8:131741988-131742010 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
1048168582 8:132084673-132084695 CAGGCTAAGGGATAAGAAGGAGG + Intronic
1048275421 8:133062340-133062362 CAGGCTCAGGAATGGAGACAAGG - Intronic
1048444357 8:134482113-134482135 CAGGCTTAGTGATGGGCAGAAGG - Intronic
1048517818 8:135126400-135126422 AGGACTCAGGGAGGGGGAGGTGG - Intergenic
1048590340 8:135815501-135815523 CAGGCTGTGGGGTGGGGAGAGGG - Intergenic
1048865685 8:138760146-138760168 CAGGCTCAGGGAAGGGGCCTGGG - Intronic
1049069414 8:140345238-140345260 CAGGAACAGAGATGGGGTGGAGG + Intronic
1049093685 8:140535294-140535316 CAGGCGCTGGGGTGGGGAGAGGG - Intronic
1049171911 8:141166825-141166847 CAGGGCCAGGGATGGGGAGGGGG + Intronic
1049249973 8:141583040-141583062 CAGGCCCAGGGATAGGGATGGGG - Intergenic
1049358383 8:142199917-142199939 TGGGCTCCGGGATGGGCAGGAGG - Intergenic
1049468721 8:142765463-142765485 CAGGGTGGGGGGTGGGGAGGAGG + Intronic
1049686244 8:143940364-143940386 GTGAGTCAGGGATGGGGAGGGGG + Intronic
1049686533 8:143941419-143941441 CAGGGTCAGGAATGGGGCAGGGG + Intronic
1049720113 8:144111797-144111819 CAGGGTCAGGGCTGGGCTGGGGG - Intronic
1049849781 8:144824675-144824697 CAGGCTCAGGGCTGTAGGGGTGG - Intergenic
1050151513 9:2622626-2622648 CAGGCGCAGTGTTGGGAAGGAGG + Intronic
1051425385 9:16926988-16927010 TAGGCCCAGAGATGGGAAGGGGG + Intergenic
1052022150 9:23537898-23537920 AAGGGTAAGGGAGGGGGAGGGGG + Intergenic
1052032884 9:23648579-23648601 TGGGGCCAGGGATGGGGAGGGGG - Intergenic
1052191686 9:25670190-25670212 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
1052913449 9:33905106-33905128 TAGGCTCTGGGATGGTGAAGTGG + Intronic
1053057877 9:35004735-35004757 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
1053266103 9:36714579-36714601 CAGGCTCAGGGTGGGGGAAGTGG + Intergenic
1053423333 9:37995128-37995150 CAGGCTGGGGGAAGGGCAGGCGG + Intronic
1053802157 9:41771453-41771475 CAGGCTCAGAGCTGGGGAACCGG - Intergenic
1054462824 9:65474717-65474739 CAGGCTCAGAGCTGGGGAACTGG + Intergenic
1054647929 9:67604978-67605000 CAGGCTCAGAGCTGGGGAACCGG + Intergenic
1054953376 9:70879602-70879624 CAGGCACTGGGGTGGGGAAGGGG - Intronic
1055392138 9:75834407-75834429 AAGGTACAGGGATGGGGTGGGGG + Intergenic
1055649927 9:78397297-78397319 GAGGCTCAGGGCTGGGGAGTGGG - Intergenic
1056098497 9:83278245-83278267 CAGTCTGAGGGGTGGGCAGGAGG + Intronic
1056878227 9:90359576-90359598 CAGGATCAGGGATGGCTGGGAGG - Intergenic
1056885042 9:90433733-90433755 CAGGCCCGGGGTGGGGGAGGGGG - Intergenic
1057016358 9:91656250-91656272 CAAGCTCTGGGCAGGGGAGGAGG + Intronic
1057034801 9:91804225-91804247 CAGGCTCAGGAACTGGCAGGAGG + Intronic
1057142226 9:92734588-92734610 CAGCCTGTGGGAGGGGGAGGAGG - Intronic
1057264309 9:93603929-93603951 CAGGCTGGGGGATCTGGAGGTGG - Intronic
1057307684 9:93921650-93921672 GGGGCTCAGGGATGGGGACCTGG - Intergenic
1057377844 9:94541117-94541139 CAGGCTAAGGGAGAAGGAGGAGG - Intergenic
1057629169 9:96706270-96706292 CAGAGGCAGGGATGGGTAGGGGG - Intergenic
1058040254 9:100294685-100294707 CAAGCTAAGGGAGGTGGAGGTGG + Intronic
1059315578 9:113423026-113423048 CAGGCACAGGGCTAGGGATGGGG - Intronic
1059374175 9:113869427-113869449 CAGGCTCCGGGATGGGATGAGGG - Intergenic
1059546308 9:115179089-115179111 CAGGCTAAGGGAGAAGGAGGAGG + Intronic
1059632727 9:116141959-116141981 GAGGGTAAGAGATGGGGAGGGGG + Intergenic
1059767089 9:117393852-117393874 CAAGCTCTGGGATATGGAGGAGG + Intronic
1060207421 9:121690422-121690444 CTGGCTAAGGGGTGGGGAGTTGG - Intronic
1060560193 9:124536316-124536338 CAAGTTCAGGGCTGGAGAGGCGG + Intronic
1060811014 9:126611566-126611588 CAGGCACAGGGAAGGTGGGGAGG + Intergenic
1060821582 9:126664396-126664418 CAGCCCCAGGGATGGGGGGGAGG + Intronic
1060848071 9:126852979-126853001 CTGGGCCAGGGATGGGGAGCAGG + Intergenic
1060937083 9:127522062-127522084 CAGGCCAGGGGCTGGGGAGGCGG + Intronic
1060964406 9:127704711-127704733 CAAGGTCAGTGATGGGGAGGGGG - Intronic
1061052798 9:128205960-128205982 CAGGCCCAGGGCAGGGGAGGGGG + Intronic
1061055949 9:128223013-128223035 CAGGCTCCAGCTTGGGGAGGTGG + Intronic
1061089904 9:128420723-128420745 CACGCACAGGGGTGGGGAGCAGG + Exonic
1061178089 9:129009292-129009314 GCTGCTCAGGGGTGGGGAGGCGG + Exonic
1061180465 9:129022437-129022459 AAGGCCAAGGGGTGGGGAGGGGG + Intronic
1061252136 9:129432662-129432684 AAGACCCAGCGATGGGGAGGAGG - Intergenic
1061408055 9:130403489-130403511 CAGGAGAAGGGTTGGGGAGGGGG - Intronic
1061567170 9:131448750-131448772 CAGGTTGGGGGATGGGGAGTGGG - Intronic
1061627193 9:131847716-131847738 CAGGCCCAGGGATGGGCATGTGG - Intergenic
1061661165 9:132131287-132131309 CAGGAGAAGGGATGGGGAGCAGG + Intergenic
1061762691 9:132861305-132861327 CTGGCTCTGGGCTGGGAAGGGGG - Intronic
1061819740 9:133220484-133220506 CAGGGCCAGGGATGAGGATGCGG - Intergenic
1061819753 9:133220553-133220575 CAGGGCCAGGGATGAGGATGTGG - Intergenic
1061819766 9:133220622-133220644 CAGGGCCAGGGATGAGGATGTGG - Intergenic
1061819782 9:133220687-133220709 CAGGGCCAGGGATGAGGATGTGG - Intergenic
1061840296 9:133354847-133354869 CAGTCACAGGGATGAGGAGCAGG + Exonic
1062083312 9:134635912-134635934 AAGGCTGAGGGTTGGGGAAGAGG + Intergenic
1062138600 9:134943296-134943318 CAGGCACATGGATGGGGAGCAGG + Intergenic
1062167357 9:135114589-135114611 CTGGGGCAGGGATGGGGACGGGG + Intronic
1062204654 9:135329345-135329367 CAAGCCCAGGGAGGGGGACGAGG + Intergenic
1062240888 9:135537329-135537351 CAGGGCCAGGGATGAGGATGTGG + Intergenic
1062246178 9:135567572-135567594 GAGTCGCAGGCATGGGGAGGGGG + Intergenic
1062261796 9:135666604-135666626 CAGGCTCTGGGAAGGGAAGGGGG - Intergenic
1062366599 9:136212550-136212572 CACGCTCAAGGCTGAGGAGGAGG - Intronic
1062483489 9:136763172-136763194 CGGGCCCGGGGATGAGGAGGCGG + Intronic
1062502916 9:136858905-136858927 CAGGAGCAGAGGTGGGGAGGTGG + Intronic
1062537035 9:137025596-137025618 CTGGCTCAGGGAGCGGGTGGAGG - Intronic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062733364 9:138121256-138121278 CAGGCCCAGGAATGGGGTTGGGG - Intronic
1185909734 X:3970663-3970685 CTGGCTTAGGGACAGGGAGGAGG - Intergenic
1187007271 X:15245230-15245252 GAGGCTCAGGGAAGGAAAGGAGG + Intronic
1187277358 X:17827835-17827857 CAGGCTGAGGGAAGGTGGGGAGG + Intronic
1187652349 X:21422404-21422426 CAGGGGCAGGGATGTGCAGGGGG - Intronic
1189116065 X:38343879-38343901 CAGGAAAAGGGATGGAGAGGGGG + Intronic
1189323125 X:40098012-40098034 CGGGCGGAGGGAGGGGGAGGAGG - Intronic
1190044130 X:47098988-47099010 GAGGGTTGGGGATGGGGAGGAGG - Intergenic
1190048084 X:47128610-47128632 CAGTCTTAGGGTTGGGGAGTTGG - Intergenic
1190244591 X:48682956-48682978 AAGGGTAAGGGATGGGGAAGTGG + Intronic
1190551516 X:51586876-51586898 CTGATGCAGGGATGGGGAGGAGG - Intergenic
1191868325 X:65724007-65724029 CAGGCTCAGTGCTGGGGGGAGGG - Intronic
1192184374 X:68936722-68936744 CAGGCACAGGGAGAAGGAGGAGG - Intergenic
1192343297 X:70281421-70281443 AAGGATGAGGGATGGGAAGGAGG - Intronic
1192547529 X:72026465-72026487 GAAGCCCAGGCATGGGGAGGAGG + Intergenic
1192718185 X:73665219-73665241 AAGGCTGAGGGAGGTGGAGGTGG + Intronic
1193178689 X:78427303-78427325 CAGACTCTGGGGAGGGGAGGTGG + Intergenic
1193487708 X:82107452-82107474 CAGGCCCAGGTGTGGAGAGGGGG - Intergenic
1195257147 X:103101848-103101870 CAGACTCAGGGAGGCGGCGGGGG + Intergenic
1195300894 X:103528793-103528815 CAGGGTCAGGAATGGGGCTGGGG + Intergenic
1195560222 X:106274777-106274799 CAAACTCAAGGATGGGGCGGAGG - Intergenic
1195561740 X:106291562-106291584 CAAACTCAAGGATGGGGCGGAGG + Intergenic
1195655792 X:107330281-107330303 CAGGCTCAGGGATGGGTCTGAGG - Intergenic
1196437932 X:115691833-115691855 CAGGCACAGAGAAGGGGAGTTGG + Intergenic
1196757107 X:119167576-119167598 AAGCCTCAGGGCTGGGGAGGAGG + Intergenic
1196943589 X:120801782-120801804 CATGCTTAGGGCTGGAGAGGAGG + Intergenic
1196992845 X:121347450-121347472 CAGGCTAAGGGAGAAGGAGGAGG + Intergenic
1197112677 X:122795291-122795313 AAGGGTCAGGGAGAGGGAGGAGG + Intergenic
1197297513 X:124737119-124737141 CAGGTGCAGGCATGAGGAGGCGG + Exonic
1197734836 X:129843195-129843217 AAGGTTCGGGGAAGGGGAGGGGG + Intronic
1199717776 X:150518516-150518538 CAGGAGAGGGGATGGGGAGGTGG + Intergenic
1199732253 X:150646957-150646979 CATGCATGGGGATGGGGAGGTGG - Intronic
1199845813 X:151692565-151692587 GAGGCACAGGGATGGGGCTGGGG + Intergenic
1199942149 X:152637674-152637696 CGGGCTGGGGGAGGGGGAGGAGG - Intergenic
1200096633 X:153667653-153667675 CAGGCTCAGGGCTGGTGCTGAGG - Intergenic
1200397452 X:155999509-155999531 CAGGGGTAGGGATGGGCAGGAGG - Intronic
1200841602 Y:7786744-7786766 CAGGGTCAGAGATAGGAAGGAGG - Intergenic
1200943186 Y:8806237-8806259 CAGTCTCAGGGACAGGCAGGAGG - Intergenic
1201283396 Y:12359930-12359952 CAGGGCAAGGGATGGGGATGAGG + Intergenic
1201731085 Y:17203953-17203975 AATTGTCAGGGATGGGGAGGAGG + Intergenic