ID: 1125200440

View in Genome Browser
Species Human (GRCh38)
Location 15:37097504-37097526
Sequence CACTAACAGCAGCTTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125200440_1125200442 -3 Left 1125200440 15:37097504-37097526 CCCAGCTCAAGCTGCTGTTAGTG 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1125200442 15:37097524-37097546 GTGACTCCCAGACCCTCAGTAGG 0: 1
1: 0
2: 1
3: 23
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125200440 Original CRISPR CACTAACAGCAGCTTGAGCT GGG (reversed) Intronic
903582806 1:24384873-24384895 CACTTACAGCAGCGGGACCTTGG - Intronic
905299580 1:36977456-36977478 TAAAAACAGCAGCTTGAGCTTGG + Intronic
905960613 1:42039590-42039612 CATGACCAGCAGCTTGACCTTGG + Intergenic
907388522 1:54141297-54141319 CACGAACACCAGCTTGACGTGGG + Exonic
907574728 1:55515922-55515944 CCCTAACGGCACCTTGACCTTGG - Intergenic
909038988 1:70628122-70628144 CACTCACATGAGCTTGTGCTTGG + Intergenic
910064283 1:83134742-83134764 TACTAACAGCCACATGAGCTTGG + Intergenic
912792462 1:112665578-112665600 ATCTAACAGCACCTTGATCTTGG - Intronic
913090237 1:115471827-115471849 CTCTACCAGCACCTTGATCTTGG + Intergenic
915935695 1:160089095-160089117 CAGCAACAGCAGCATGACCTGGG - Exonic
916340687 1:163730260-163730282 CACCAACTTCACCTTGAGCTAGG - Intergenic
916983203 1:170162155-170162177 AACTAACAGCAGCTTTATCTTGG - Intronic
918405587 1:184208770-184208792 CACAAACAGGAGCCTCAGCTGGG + Intergenic
920324253 1:205149591-205149613 CACTAACACCAGCTTAATCATGG + Intronic
920670614 1:208001356-208001378 CAGCAACAGCAGCTTCACCTGGG + Intergenic
921085913 1:211792401-211792423 CACAAAAAGCAGCTTTAGCCTGG - Intronic
921532881 1:216307233-216307255 CACTCAGAGCAGCTTCAGCAAGG - Intronic
924953329 1:248905919-248905941 ATCTAACAGCAGCTTCACCTGGG - Intergenic
1063190420 10:3688964-3688986 CTCTGACAGCATCTTGAGCATGG - Intergenic
1063394909 10:5677773-5677795 CCCTGGCAGCAGCTTTAGCTTGG + Intergenic
1065626116 10:27630306-27630328 CATTAACAGCATCTTGACCTAGG - Intergenic
1066405074 10:35110623-35110645 CCCTACCAGCATCTTGATCTTGG - Intergenic
1067185553 10:44024249-44024271 CCCTACCAGCACCTTGATCTTGG + Intergenic
1069778339 10:70939661-70939683 CACTAGCAGCAGTGTGAGCAAGG + Intergenic
1070461420 10:76674290-76674312 CACTATCAGAAGCTTCAGCTTGG - Intergenic
1072159852 10:92755838-92755860 CAATAAGAGCAGATTGTGCTGGG - Intergenic
1073546174 10:104351097-104351119 CACACAAAGCAGCCTGAGCTGGG + Intergenic
1077001926 11:327577-327599 CACTCACAGCAGTTTGAGAATGG - Intergenic
1077005436 11:353229-353251 CACCAATAGCAGCTCGGGCTGGG - Intergenic
1077399075 11:2344331-2344353 CACTACCAACACCTTGATCTCGG + Intergenic
1077401969 11:2363383-2363405 CCCCAACAACAACTTGAGCTTGG - Intergenic
1077780598 11:5324808-5324830 CTCTAACAGTTACTTGAGCTTGG + Intronic
1080750929 11:35149417-35149439 ACTTAACAGCAGCGTGAGCTTGG + Intronic
1083211531 11:61190427-61190449 CCCTACCAACACCTTGAGCTTGG - Intergenic
1084077147 11:66788595-66788617 CCCTGACAGCACCTTGATCTTGG - Intronic
1085730687 11:78996129-78996151 CACTAACCTCATCATGAGCTAGG + Intronic
1087334540 11:96826594-96826616 CACTGACAACACCTTGACCTTGG - Intergenic
1087693161 11:101345624-101345646 TATTAACAGCACCTTGGGCTGGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089126508 11:116180235-116180257 CCCTGACAACACCTTGAGCTTGG + Intergenic
1089136679 11:116254835-116254857 CCCTGACAGCATCTTGATCTTGG - Intergenic
1090939402 11:131373999-131374021 TGCCAGCAGCAGCTTGAGCTGGG + Intronic
1092071050 12:5631717-5631739 CAGTCACAGCAGCATGAGCAAGG + Intronic
1093228696 12:16516236-16516258 AAGTAACAATAGCTTGAGCTAGG - Intronic
1094357316 12:29591504-29591526 CACTGTCAGCAGCCTGAGTTTGG - Intronic
1095484487 12:42671227-42671249 CACTAGTAACAGCTTGAGCCAGG - Intergenic
1096071725 12:48779281-48779303 CACTAACAGCTGTGTGATCTTGG - Intronic
1096212819 12:49779461-49779483 CACTGACATCACCTTGATCTTGG - Intergenic
1098109123 12:67102948-67102970 CCCTCACAGCACCTTGATCTTGG - Intergenic
1099144596 12:79024301-79024323 CACAAACAGAAGCTTGGGATAGG - Intronic
1100190894 12:92190562-92190584 CTCTACCAGCACCTTGACCTTGG + Intergenic
1100583390 12:95956869-95956891 CACGCGCAGCATCTTGAGCTCGG - Exonic
1101012517 12:100465853-100465875 ACCTAACAACACCTTGAGCTTGG - Intergenic
1101598138 12:106185337-106185359 CCCTAACAGTAGCATGAGGTAGG - Intergenic
1101750087 12:107576377-107576399 CCCTGCCAGCAGCTTGATCTGGG - Intronic
1102187424 12:110959798-110959820 CACTGACAGCTGCCTGGGCTAGG + Intergenic
1103205604 12:119126317-119126339 TACAAAGAGCAGCTAGAGCTGGG - Intronic
1103249193 12:119485493-119485515 CGCTGACAGCACCTTGATCTTGG - Intronic
1103826348 12:123742201-123742223 CACAAAAAGCAGCTGGAACTGGG - Intronic
1104648207 12:130511965-130511987 CCCTCACAGAAGCCTGAGCTTGG - Intronic
1105002907 12:132702732-132702754 CCCTAGCAGCAGCCTGGGCTGGG - Intronic
1106638221 13:31553964-31553986 CACTAACATTAGCTTATGCTTGG + Intergenic
1107013613 13:35691757-35691779 CCCTGACAGCACCTTGACCTTGG - Intergenic
1113207013 13:107928901-107928923 CACTCACAGGTGCTAGAGCTGGG + Intergenic
1113657627 13:112078282-112078304 CAGCAACAGCAGCCTCAGCTGGG - Intergenic
1114635345 14:24184019-24184041 CAGTGACAGCAGCATGAGCGTGG + Exonic
1115888579 14:38001817-38001839 CAGCAACAGCAGCATTAGCTGGG - Intronic
1117057138 14:51924092-51924114 CACTAACATCATATTGAGATTGG + Intronic
1119069892 14:71572006-71572028 CACCAGCAGCAGCTGGACCTTGG - Intronic
1125093824 15:35828150-35828172 CCCTAACAGCAGCTTGCAGTTGG - Intergenic
1125200440 15:37097504-37097526 CACTAACAGCAGCTTGAGCTGGG - Intronic
1126764787 15:52001235-52001257 ACCTACCAGCACCTTGAGCTTGG + Intronic
1127976277 15:63999439-63999461 CACTCACAGCAGCTTGCCCAAGG + Intronic
1128093287 15:64933467-64933489 CACCAAGACCAGCTTGTGCTGGG + Intronic
1130407836 15:83617928-83617950 CACAAACGGCACCGTGAGCTGGG + Intronic
1136101955 16:28003259-28003281 CACTCACAGGAGCTTGAGAATGG + Intronic
1137469671 16:48743183-48743205 GACTTACAGCAGCTTCAGTTAGG + Intergenic
1137591166 16:49694787-49694809 TCCTAACAGCATCTTGAGGTAGG + Intronic
1138104333 16:54279581-54279603 AACTAACACCAGCTTGAGTGGGG - Intergenic
1138571174 16:57874207-57874229 CACTAACAGCAGCCTGGGGTGGG + Intergenic
1139701818 16:68712347-68712369 CAACAAGAGCAGCTGGAGCTGGG + Intronic
1139795437 16:69479599-69479621 CATTAACAGTAGATTGAGGTGGG - Intergenic
1143720375 17:8805026-8805048 CACGAGCAGCAGCCTGAACTAGG + Intronic
1143978551 17:10847996-10848018 CCCTACCAGCACCTTGATCTTGG + Intergenic
1150264126 17:63820888-63820910 CAATAACAGCACCTAGAGCAAGG + Exonic
1151264622 17:72945225-72945247 CAGTGACGGCAGCCTGAGCTGGG - Intronic
1152908690 17:82984646-82984668 CCCTGCCAGCAGCCTGAGCTTGG + Intronic
1154314827 18:13296393-13296415 CCCTGACAGCACCTTGATCTTGG - Intronic
1158900010 18:61953741-61953763 CCATGACAGCAGCTTGAGTTGGG - Intergenic
1159781871 18:72669009-72669031 GACTACCAGCACCTTGATCTTGG + Intergenic
1160188881 18:76698284-76698306 AACAAACAGCATCTGGAGCTTGG - Intergenic
1162392918 19:10400302-10400324 CACTAACAGCAGCTGTCTCTGGG + Intronic
1162557210 19:11394651-11394673 CAGTGACAGCAGAATGAGCTTGG - Intronic
1163112333 19:15169322-15169344 CCCTGACAGCACCTTGGGCTTGG + Intronic
1164439870 19:28267444-28267466 ATCTAACAGCACCTTGATCTTGG - Intergenic
1164753458 19:30672590-30672612 TACTAACAGATTCTTGAGCTAGG - Intronic
1165528467 19:36376870-36376892 CACTTAAAGCTGCCTGAGCTTGG - Intronic
1165640567 19:37382244-37382266 CCCTGACAGCAGCTAAAGCTAGG + Intronic
1167537663 19:50065383-50065405 CAGTAATAGCACCTTGAGCTAGG + Intergenic
925264731 2:2559102-2559124 CCCTGACAGCACCTTGACCTTGG + Intergenic
925805004 2:7640222-7640244 CTTTAACAGCAGCTTGAGAATGG - Intergenic
925916121 2:8607598-8607620 CACGAACAGCAGGCAGAGCTGGG - Intergenic
928100342 2:28433626-28433648 CCCTGACAGCACCTTGATCTTGG - Intergenic
928265834 2:29810985-29811007 CTCTGACAGCACCTTGATCTTGG + Intronic
930716189 2:54596125-54596147 CAGTCACAGCAGCTTGAGCTTGG + Intronic
932167498 2:69521599-69521621 CAGTAACAGAAGTTTTAGCTGGG + Intronic
932561363 2:72873504-72873526 CCCTGACAGCACCTTGATCTTGG + Intergenic
933835421 2:86241683-86241705 AACTAACAGCTGCATGACCTTGG + Intronic
937125832 2:119474504-119474526 CACTTACACCGGCCTGAGCTGGG - Intronic
938131661 2:128721113-128721135 CTCTACCAGCACCTTGATCTTGG - Intergenic
938692140 2:133801563-133801585 CACTTAAAGGAGCCTGAGCTGGG + Intergenic
941815607 2:169792631-169792653 ATCTAACAGCATCTTGATCTTGG + Intronic
943197081 2:184767080-184767102 CCTTAACAGCACCTTGATCTTGG + Intronic
943347441 2:186756525-186756547 CCCTGACAGCACCTTGACCTTGG - Intronic
1170419662 20:16180372-16180394 CCCTACCAGCACCTTGACCTTGG - Intergenic
1170781326 20:19428148-19428170 CAGTAGCAGCAGCATGAGCCCGG + Intronic
1171152002 20:22835486-22835508 GAGGAAGAGCAGCTTGAGCTAGG + Intergenic
1177152667 21:17470356-17470378 AACTAACAGCAGGTCGAGCGTGG - Intergenic
1179058805 21:37960482-37960504 CTCTGACAGCATCTTGATCTTGG - Intronic
1179069322 21:38056873-38056895 CAATAACAGCAGCTTTGGTTTGG - Intronic
1181864739 22:25846264-25846286 CACCATCTGCAGCTTGATCTGGG - Exonic
1182999421 22:34842917-34842939 CACTAACAGGTGCTTGAGTTGGG - Intergenic
1183857148 22:40642454-40642476 CACTCACAGCAGCTGGGGCATGG + Intergenic
1183949906 22:41347151-41347173 CACCAGCAGCAGCTGGTGCTGGG - Intronic
952111854 3:30133361-30133383 ATCTAACAGCACCTTGATCTTGG - Intergenic
952336201 3:32405113-32405135 CACTAACAGCCATGTGAGCTCGG + Intronic
952955438 3:38554388-38554410 CACAAAGAGCAGGTTGATCTTGG + Exonic
955979791 3:64513194-64513216 CCCTGACAGCACCTTGATCTCGG + Intergenic
959612620 3:108312460-108312482 CACTCACAGCAGCTGGAGTTTGG - Intronic
959622219 3:108410825-108410847 CACCAGCTGCAGCTGGAGCTCGG - Exonic
959845536 3:111028291-111028313 CCCTAACTGCAGCTTGTGTTTGG + Intergenic
959849403 3:111070647-111070669 CAGTACCGGCAGCTTGACCTTGG - Intronic
961929860 3:130521880-130521902 CACTATGAGCAGCTGGAGCTCGG - Intergenic
962948280 3:140194208-140194230 CACTGACAGCACCTTGATCTTGG - Intronic
964110334 3:153080908-153080930 CATTAAGAACAGCTTCAGCTTGG - Intergenic
964718732 3:159750654-159750676 CACTCACAGCAGCTGGGGGTAGG + Intronic
964965866 3:162492671-162492693 CAATAACAGCAGTTTAGGCTTGG + Intergenic
965293334 3:166912143-166912165 AACTGACAGCAGCTTGATCTTGG - Intergenic
965739792 3:171862031-171862053 CACTAAGAGAATCTTGTGCTAGG - Intronic
965897895 3:173600015-173600037 CACTAACAGGTGCTAGAGTTGGG - Intronic
966039044 3:175458020-175458042 CAGTAATAGCAACTTCAGCTGGG + Intronic
966970989 3:185045315-185045337 CAGTCACAGAAGCCTGAGCTCGG - Intronic
968496784 4:922579-922601 CACTGACAGCATCTTGCTCTTGG + Intronic
968841733 4:3011970-3011992 CACTTCCAGCAGCGTGATCTTGG + Intronic
969790420 4:9490751-9490773 GACAAACAGCAGAGTGAGCTGGG + Intergenic
973849568 4:54947788-54947810 CAATACCAACAGCTTGATCTTGG + Intergenic
976568821 4:86584844-86584866 CACCAATAGCAGCTTGAATTGGG - Intronic
976831985 4:89325694-89325716 TTCTTACAGCAGCCTGAGCTTGG - Intergenic
978079768 4:104578004-104578026 CACTATCAGCAGCCAGAGTTAGG + Intergenic
979120717 4:116896762-116896784 CACTGACAGCACTTTGATCTTGG + Intergenic
979478442 4:121185744-121185766 CACTAGCAGCAGCTTCAGAATGG + Intronic
981243538 4:142507664-142507686 GAGTATCAGCAGCTTGAACTTGG + Intronic
982467748 4:155751110-155751132 CACTAAAATCAGCTTTACCTAGG + Intergenic
985175120 4:187192458-187192480 CCCTACCAGCATCTTGACCTTGG + Intergenic
985270938 4:188194535-188194557 CACTCACAGCAGCTACATCTGGG + Intergenic
987801912 5:22709002-22709024 AACAAACAGGAGCTTGAACTGGG + Intronic
989631218 5:43484255-43484277 TACTACCAGAAGCTTGAGCTGGG + Intergenic
991575706 5:68101378-68101400 CACTAGCAGCAGTTTCACCTGGG + Intergenic
992358014 5:76005632-76005654 CAATAACAGCATATTGATCTAGG - Intergenic
992387101 5:76295180-76295202 ATCTGCCAGCAGCTTGAGCTTGG - Intronic
992485544 5:77190994-77191016 CCCTGACAGCACCTTGATCTTGG - Intergenic
993204302 5:84860897-84860919 CACCAACAGGAGCCTGAGATGGG + Intergenic
993531788 5:89034325-89034347 CAATAACAGAAGCTTGGGCTGGG - Intergenic
994885193 5:105551233-105551255 CACTGTCAACAGCTTGATCTTGG + Intergenic
994981260 5:106876793-106876815 CACCAACATGAGCTTGTGCTTGG - Intergenic
996507290 5:124282169-124282191 CACCAATAGAAGCTTGATCTTGG + Intergenic
999836756 5:155382054-155382076 CACTCACTGCAGCCTGGGCTGGG + Intergenic
1001090255 5:168734890-168734912 CACTGAAAGCAACTTGTGCTTGG - Intronic
1001653030 5:173328744-173328766 CTTTAACAGCAACTGGAGCTTGG - Exonic
1004207736 6:13608004-13608026 CACTTTTAGGAGCTTGAGCTAGG - Intronic
1007220892 6:40277907-40277929 CACTAACAGCTGTGTGACCTTGG - Intergenic
1007558696 6:42787556-42787578 CACTAACAACGGCTAAAGCTTGG + Intronic
1008033133 6:46719381-46719403 CACTGGCACCAGCTGGAGCTTGG + Intronic
1008692593 6:53997346-53997368 CACTAACTGAAACTTGAGTTAGG + Intronic
1008805624 6:55423797-55423819 CACTAAAAGAAGCTACAGCTAGG - Intergenic
1010274854 6:73957518-73957540 CACTGACAGCACCTTGATCTTGG - Intergenic
1013368480 6:109451795-109451817 CACTCACCGCAGCCTAAGCTGGG - Intronic
1013540725 6:111105820-111105842 CACTTCCAGCACCTTCAGCTGGG - Intronic
1013839834 6:114378238-114378260 AGATGACAGCAGCTTGAGCTAGG - Intergenic
1014752082 6:125268036-125268058 CACTCACATGAGCTTGTGCTTGG + Intronic
1018013556 6:159693155-159693177 CACTAGCAGCATGTTGAGCCGGG - Exonic
1018777223 6:167028732-167028754 CTCTAAAAGCAGCATGACCTTGG - Intronic
1018937797 6:168284884-168284906 CACTATCACCACCTTGTGCTTGG + Intergenic
1019342339 7:514440-514462 CACTCTCGGCATCTTGAGCTGGG - Intronic
1024586688 7:50848533-50848555 GTCTACCAGCAGCTTGATCTTGG - Intergenic
1025715246 7:63950056-63950078 AAGAAACAGCAGCTTCAGCTTGG + Intergenic
1027279825 7:76600000-76600022 TACTAACAGCCACATGAGCTTGG - Intergenic
1028978079 7:96936157-96936179 CCCCAACAGCACCTTGATCTTGG + Intergenic
1030235042 7:107249370-107249392 CACTATCAACATTTTGAGCTGGG - Intronic
1032957885 7:136993627-136993649 CACTAAAATAAGCTCGAGCTAGG + Intronic
1034133296 7:148740891-148740913 CCCTGACAGTACCTTGAGCTCGG + Intronic
1034288559 7:149908205-149908227 CCCTGACAGCACCTTGATCTTGG + Intergenic
1034662516 7:152784662-152784684 CCCTGACAGCACCTTGATCTTGG - Intronic
1035561820 8:610302-610324 CAATAACAGCATCCTGGGCTGGG + Intergenic
1038341003 8:26684879-26684901 CCCTACCAGCACCTTGATCTTGG + Intergenic
1041690926 8:60686261-60686283 CACTAACTTCAGCTTCAGATGGG + Intronic
1043350810 8:79359124-79359146 ATCTACCAGCAGCTTGATCTGGG + Intergenic
1044225959 8:89718373-89718395 TAGTGAGAGCAGCTTGAGCTTGG - Intergenic
1044861883 8:96532008-96532030 CATTAACAGCTGGTTGACCTTGG + Intronic
1045620535 8:103972397-103972419 CAATAACAGCAGCTTTAACTAGG - Intronic
1046627804 8:116593721-116593743 CACTGCCAGCACCTTGATCTTGG + Intergenic
1048549918 8:135424784-135424806 CACTGCCAGCACCTTGATCTTGG - Intergenic
1049984021 9:931565-931587 CTCTGACAGCACCTTGATCTTGG - Intronic
1051593920 9:18804671-18804693 GACTAAAATCAGCATGAGCTAGG - Intronic
1052367997 9:27635109-27635131 CAGTAACATCAGCTTTACCTGGG + Intergenic
1052790697 9:32873177-32873199 CACTCACTGCAGCTCAAGCTTGG + Intergenic
1055183299 9:73417273-73417295 GACTACTAGCACCTTGAGCTTGG + Intergenic
1057624835 9:96667852-96667874 AACCAAAAGCAGCTTGAGATGGG + Intergenic
1057912074 9:99026922-99026944 CACTAATAGAGGCTTGTGCTAGG - Intronic
1059153126 9:111966933-111966955 AACTGCCAGCAGCTTGATCTTGG + Intergenic
1059693015 9:116704013-116704035 CACTAACTTCAGCCTTAGCTTGG - Intronic
1062104713 9:134748443-134748465 CACAGACAGCAGCTTGTCCTTGG + Intronic
1187960417 X:24562313-24562335 CTCTATCAGCAGCATGAGCGAGG - Exonic
1189605612 X:42674568-42674590 CCCTACCAGCATCTTGATCTTGG - Intergenic
1191840380 X:65509546-65509568 GACTAACAGTAGCTTGACCGGGG - Intergenic
1196021735 X:110997939-110997961 CACCACCAGCACCTTGATCTTGG + Intronic
1196319026 X:114266934-114266956 CACTAACAGCATTTTGAAGTAGG + Intergenic
1196562160 X:117162844-117162866 CAGTAACAGATGCTGGAGCTTGG + Intergenic
1196700913 X:118667288-118667310 CACTATCAGGATCTTGAGGTAGG - Intronic