ID: 1125201111

View in Genome Browser
Species Human (GRCh38)
Location 15:37101355-37101377
Sequence GCGCGCGCGCACGGGCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125201111_1125201115 1 Left 1125201111 15:37101355-37101377 CCCGCGCGCCCGTGCGCGCGCGC No data
Right 1125201115 15:37101379-37101401 ACTAGTGTGCGTCTCCAAAGTGG No data
1125201111_1125201117 18 Left 1125201111 15:37101355-37101377 CCCGCGCGCCCGTGCGCGCGCGC No data
Right 1125201117 15:37101396-37101418 AAGTGGATCTCACTCAGAGCTGG No data
1125201111_1125201119 28 Left 1125201111 15:37101355-37101377 CCCGCGCGCCCGTGCGCGCGCGC No data
Right 1125201119 15:37101406-37101428 CACTCAGAGCTGGGAAGCACAGG No data
1125201111_1125201118 19 Left 1125201111 15:37101355-37101377 CCCGCGCGCCCGTGCGCGCGCGC No data
Right 1125201118 15:37101397-37101419 AGTGGATCTCACTCAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125201111 Original CRISPR GCGCGCGCGCACGGGCGCGC GGG (reversed) Intergenic