ID: 1125201915

View in Genome Browser
Species Human (GRCh38)
Location 15:37107484-37107506
Sequence CGCCGGGTAGGGAGGTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125201909_1125201915 -7 Left 1125201909 15:37107468-37107490 CCGGTAAACAATCGAACGCCGGG No data
Right 1125201915 15:37107484-37107506 CGCCGGGTAGGGAGGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125201915 Original CRISPR CGCCGGGTAGGGAGGTCAGA GGG Intergenic
No off target data available for this crispr