ID: 1125201915 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:37107484-37107506 |
| Sequence | CGCCGGGTAGGGAGGTCAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1125201909_1125201915 | -7 | Left | 1125201909 | 15:37107468-37107490 | CCGGTAAACAATCGAACGCCGGG | No data | ||
| Right | 1125201915 | 15:37107484-37107506 | CGCCGGGTAGGGAGGTCAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1125201915 | Original CRISPR | CGCCGGGTAGGGAGGTCAGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||