ID: 1125207219

View in Genome Browser
Species Human (GRCh38)
Location 15:37167377-37167399
Sequence CTGTGAGCCTGTTAGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125207213_1125207219 -7 Left 1125207213 15:37167361-37167383 CCAACCCCTGATGGGTCTGTGAG No data
Right 1125207219 15:37167377-37167399 CTGTGAGCCTGTTAGGAACTGGG No data
1125207212_1125207219 -6 Left 1125207212 15:37167360-37167382 CCCAACCCCTGATGGGTCTGTGA No data
Right 1125207219 15:37167377-37167399 CTGTGAGCCTGTTAGGAACTGGG No data
1125207211_1125207219 -5 Left 1125207211 15:37167359-37167381 CCCCAACCCCTGATGGGTCTGTG No data
Right 1125207219 15:37167377-37167399 CTGTGAGCCTGTTAGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125207219 Original CRISPR CTGTGAGCCTGTTAGGAACT GGG Intergenic
No off target data available for this crispr