ID: 1125210428

View in Genome Browser
Species Human (GRCh38)
Location 15:37208547-37208569
Sequence TAGGGATCCCAGCACTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125210428_1125210431 15 Left 1125210428 15:37208547-37208569 CCATCATAGTGCTGGGATCCCTA No data
Right 1125210431 15:37208585-37208607 ATTCCTACTTCACAGAAATAAGG No data
1125210428_1125210433 26 Left 1125210428 15:37208547-37208569 CCATCATAGTGCTGGGATCCCTA No data
Right 1125210433 15:37208596-37208618 ACAGAAATAAGGACTGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125210428 Original CRISPR TAGGGATCCCAGCACTATGA TGG (reversed) Intergenic
No off target data available for this crispr