ID: 1125210431

View in Genome Browser
Species Human (GRCh38)
Location 15:37208585-37208607
Sequence ATTCCTACTTCACAGAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125210429_1125210431 -3 Left 1125210429 15:37208565-37208587 CCCTATCATTTTATTTTTTGATT No data
Right 1125210431 15:37208585-37208607 ATTCCTACTTCACAGAAATAAGG No data
1125210428_1125210431 15 Left 1125210428 15:37208547-37208569 CCATCATAGTGCTGGGATCCCTA No data
Right 1125210431 15:37208585-37208607 ATTCCTACTTCACAGAAATAAGG No data
1125210430_1125210431 -4 Left 1125210430 15:37208566-37208588 CCTATCATTTTATTTTTTGATTC No data
Right 1125210431 15:37208585-37208607 ATTCCTACTTCACAGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125210431 Original CRISPR ATTCCTACTTCACAGAAATA AGG Intergenic
No off target data available for this crispr