ID: 1125211731 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:37224488-37224510 |
Sequence | GTGATCAGTCTTTCATAAGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1125211729_1125211731 | -9 | Left | 1125211729 | 15:37224474-37224496 | CCAACAAGAAGAATGTGATCAGT | No data | ||
Right | 1125211731 | 15:37224488-37224510 | GTGATCAGTCTTTCATAAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1125211731 | Original CRISPR | GTGATCAGTCTTTCATAAGG AGG | Intergenic | ||