ID: 1125211731

View in Genome Browser
Species Human (GRCh38)
Location 15:37224488-37224510
Sequence GTGATCAGTCTTTCATAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125211729_1125211731 -9 Left 1125211729 15:37224474-37224496 CCAACAAGAAGAATGTGATCAGT No data
Right 1125211731 15:37224488-37224510 GTGATCAGTCTTTCATAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125211731 Original CRISPR GTGATCAGTCTTTCATAAGG AGG Intergenic