ID: 1125214994

View in Genome Browser
Species Human (GRCh38)
Location 15:37261995-37262017
Sequence CTACAATACTACCTAAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125214994_1125215002 17 Left 1125214994 15:37261995-37262017 CCACATCTTAGGTAGTATTGTAG No data
Right 1125215002 15:37262035-37262057 TAGGGAGGTTGTGGTGCTGGAGG No data
1125214994_1125215001 14 Left 1125214994 15:37261995-37262017 CCACATCTTAGGTAGTATTGTAG No data
Right 1125215001 15:37262032-37262054 AATTAGGGAGGTTGTGGTGCTGG No data
1125214994_1125214999 2 Left 1125214994 15:37261995-37262017 CCACATCTTAGGTAGTATTGTAG No data
Right 1125214999 15:37262020-37262042 GCTGGGTCTCACAATTAGGGAGG No data
1125214994_1125214997 -2 Left 1125214994 15:37261995-37262017 CCACATCTTAGGTAGTATTGTAG No data
Right 1125214997 15:37262016-37262038 AGATGCTGGGTCTCACAATTAGG No data
1125214994_1125215000 8 Left 1125214994 15:37261995-37262017 CCACATCTTAGGTAGTATTGTAG No data
Right 1125215000 15:37262026-37262048 TCTCACAATTAGGGAGGTTGTGG No data
1125214994_1125214998 -1 Left 1125214994 15:37261995-37262017 CCACATCTTAGGTAGTATTGTAG No data
Right 1125214998 15:37262017-37262039 GATGCTGGGTCTCACAATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125214994 Original CRISPR CTACAATACTACCTAAGATG TGG (reversed) Intergenic
No off target data available for this crispr