ID: 1125214999

View in Genome Browser
Species Human (GRCh38)
Location 15:37262020-37262042
Sequence GCTGGGTCTCACAATTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125214994_1125214999 2 Left 1125214994 15:37261995-37262017 CCACATCTTAGGTAGTATTGTAG No data
Right 1125214999 15:37262020-37262042 GCTGGGTCTCACAATTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125214999 Original CRISPR GCTGGGTCTCACAATTAGGG AGG Intergenic
No off target data available for this crispr