ID: 1125221037

View in Genome Browser
Species Human (GRCh38)
Location 15:37335777-37335799
Sequence CCTACTTCTGAGAAGTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125221034_1125221037 -8 Left 1125221034 15:37335762-37335784 CCTTAATTAGTTATGCCTACTTC No data
Right 1125221037 15:37335777-37335799 CCTACTTCTGAGAAGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125221037 Original CRISPR CCTACTTCTGAGAAGTTGGC AGG Intergenic
No off target data available for this crispr