ID: 1125225499

View in Genome Browser
Species Human (GRCh38)
Location 15:37390717-37390739
Sequence TTCCTGCCACCACGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5958
Summary {0: 11, 1: 270, 2: 1186, 3: 1922, 4: 2569}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125225499_1125225500 -10 Left 1125225499 15:37390717-37390739 CCTTCTTCACGTGGTGGCAGGAA 0: 11
1: 270
2: 1186
3: 1922
4: 2569
Right 1125225500 15:37390730-37390752 GTGGCAGGAAAGACAGAATGAGG No data
1125225499_1125225502 -6 Left 1125225499 15:37390717-37390739 CCTTCTTCACGTGGTGGCAGGAA 0: 11
1: 270
2: 1186
3: 1922
4: 2569
Right 1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG No data
1125225499_1125225501 -7 Left 1125225499 15:37390717-37390739 CCTTCTTCACGTGGTGGCAGGAA 0: 11
1: 270
2: 1186
3: 1922
4: 2569
Right 1125225501 15:37390733-37390755 GCAGGAAAGACAGAATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125225499 Original CRISPR TTCCTGCCACCACGTGAAGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr